Interactions between single nucleotide polymorphism of SERPINA1 gene and smoking in association with COPD: a case–control study

Figures & data

Figure 1 The flow chart of population selection.

Notes: The subjects were selected using questionnaire interview, lung function examination and COPD diagnosis according to GOLD Guidelines 2015. A total of 120 patients confirmed COPD diagnosis and 481 healthy adults confirmed by further examinations were screened for genotyping.
Abbreviation: GOLD, Global initiative for chronic Obstructive Lung Disease.

Table 1 SNPs and primers design

SNPs	Primers
rs8004738	Forward	5′–GCAGCAACCCTCAGAGTCCT–3′
	Reverse	5′–ACTGGGCTGTGGTTGAGGTC–3′
rs1243160	Forward	5′–TGACCTGGGACAGGAATCG–3′
	Reverse	5′–GCACCTCAGCAGGCGGATA–3′
rs2854254	Forward	5′–TGACCTGGGACAGGAATCG–3′
	Reverse	5′–GCACCTCAGCAGGCGGATA–3′

Abbreviation: SNPs, single nucleotide polymorphisms.

Table 2 Baseline characteristics of subjects by study group

Characteristics	Category	COPD group	Control group	P-value
Age (years)		65.3±11.3	49.3±10.4	<0.001
Gender	Male	92	322	0.040
	Female	28	159
Smokers	Yes	65	163	<0.001
	No	55	318
BMI (kg/m^2)	<24	79	220	<0.001
	24–28	40	189
	>28	1	72
Educational status	Less than secondary	27	47	<0.001
	Senior high to college	51	184
	University or higher	42	250
Material for cooking	Liquefied gas or natural gas	89	389	0.103
	Firewood or grass	31	92
Material for heating	Heating installation or electricity	87	387	0.056
	Coal	33	94
History of occupational exposure to dust	Yes	15	46	0.341
	No	105	435
History of allergy	Yes	14	92	0.055
	No	106	389

Table 3 Results of stepwise logistic regression analyses showing risk factors for COPD

	β	SE	Wald	P-value	OR	95% CI
Age	0.114	0.015	56.441	<0.001	1.121	1.088–1.155
Gender (female vs male)	−1.055	0.416	6.426	0.011	0.348	0.154–0.787
Smoking status	0.101	0.003	18.260	<0.001	1.011	1.006–1.016
Educational level (high vs low)	−1.130	0.281	16.128	<0.001	0.323	0.186–0.561
rs8004738 (non-GG vs GG)	1.373	0.433	10.040	0.002	3.948	1.688–9.232

Notes: Variables selected by stepwise logistic regression. SNP rs8004738 genotypes were divided as GG and non-GG (G/A and A/A).

Abbreviations: SE, standard error; OR, odds ratio; CI, confidence interval.

Table 4 Association between smoking index and COPD risk

Smoking index (number × year)	Case group (n, %) n=120	Control group (n, %) n=481	OR	95% CI	P-value
Nonsmoker	55	318	1.000
Smoker	65	163	2.306	1.537–3.459	<0.001
<1	55 (45.8)	318 (82.5)	1.000
1–400	37 (30.8)	107 (15.8)	1.999	1.249–3.201	0.004
400–800	13 (10.8)	36 (0.9)	2.088	1.041–4.187	0.035
>800	15 (12.5)	20 (0.9)	4.336	2.094–8.981	<0.001

Notes: Data presented as frequency (proportion), ORs and 95% CI by logistic regression. Confounding factors included age, gender, educational levels, and genetic variations.

Abbreviations: OR, odds ratio; CI, confidence interval.

Table 5 SNP genotypes frequencies in COPD case and control groups

SNP	Genotypes	Genotype frequency		P-value
		COPD	Control
rs8004738	G/G	40	221	0.042
	G/A	59	187
	A/A	21	73
	G:A	139:101	629:333	0.031
rs2854254	G/G	94	381	0.930
	G/A	22	85
	A/A	4	15
	G:A	210:30	847:115	0.816
rs1243160	C/C	116	464	0.774
	C/T	4	15
	T/T	0	2
	C:T	236:4	237:3	0.755

Abbreviation: SNP, single nucleotide polymorphism.

Table 6 Interactions between smoking and rs8004738 genotypes in association with chronic obstructive pulmonary disease

Risk factors		Case	Control	OR	95% CI	P-value	RERI	AP	S
Smoking	Genotype
No	GG	18	150	1.000			0.478	0.123	1.197
Yes	GG	22	71	2.582	1.303–5.117	0.005
No	Non-GG	37	168	1.835	1.002–3.360	0.047
Yes	Non-GG	43	92	3.895	2.120–7.157	<0.001

Note: SNP rs8004738 genotypes were divided as GG and non-GG (G/A and A/A).

Abbreviations: RERI, relative excess risk due to interaction; AP, attributable proportion due to interaction; S, synergy index; OR, odds ratio.