Fine-particulate matter aggravates cigarette smoke extract–induced airway inflammation via Wnt5a–ERK pathway in COPD

Figures & data

Table 1 Primer sequences

Genes	Forward primer	Reverse primer
Actb (mouse)	AACCCTAAGGCCAACCGTGAAA	GATGGCGTGAGGGAGAGCATA
IL6 (mouse)	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
IL8 (mouse)	TGTTGAGCATGAAAAGCCTCTAT	AGGTCTCCCGAATTGGAAAGG′
Wnt5a (mouse)	CAACTGGCAGGACTTTCTCAA′	CCTTCTCCAATGTACTGCATGTG
ACTB (human)	AGAAAATCTGGCACCACACCT	GATAGCACAGCCTGGATAGCA
IL6 (human)	ACTCACCTCTTCAGAACGAATTG′	CCATCTTTGGAAGGTTCAGGTTG
IL8 (human)	ACTGAGAGTGATTGAGAGTGGAC′	AACCCTCTGCACCCAGTTTTC
WNT5A (human)	GCCAGTATCAATTCCGACATCG	TCACCGCGTATGTGAAGGC

Figure 1 PM_2.5 aggravated smoking-induced histological changes and inflammation in lungs of mice.

Notes: (A–D) H&E-stained sections of lung from control, PM_2.5, smoking, and PM_2.5 + smoking groups (original magnification 200×, bar 100 μm); (E, F) IL6 and IL8 mRNA expression in lungs of mice (normalized to β-actin level, n=5 mice/group). Data expressed as mean ± SD. *P<0.05; ***P<0.001.
Abbreviation: PM_2.5, particulate matter ≤2.5 μm.

Figure 2 PM_2.5 or CSE exposure increased production of cytokines in 16HBE cells.

Notes: (A) Cells left unexposed or variably exposed to CSE (2.5%, 5%, 10%, or 20%) for 24 hours; (B) cells left unexposed or variably exposed to 10% CSE (6, 12, 24, or 48 hours); (C) cells left unexposed or variably exposed to PM_2.5 (25 μg/mL, 50 μg/mL, 100 μg/mL, or 200 μg/mL) for 24 hours; (D) cells left unexposed or variably exposed to 100 μg/mL PM_2.5 (6, 12, 24, or 48 hours). Levels of IL6 and IL8 determined in culture supernatants (ELISA). Data expressed as mean ± SD. *P<0.05; **P<0.01; ***P<0.001.
Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.

Figure 3 PM_2.5 aggravated CSE-induced inflammation in 16HBE cells.

Notes: (A) Cell viability assessed after exposure to PM_2.5 (25–200 μg/mL) in combination with 10% CSE for 24 hours; (B–E) cells left unexposed or exposed to PM_2.5 (100 μg/mL), CSE (10%), or PM_2.5 (100 μg/mL) + CSE (10%) for 24 hours. Levels of IL6 and IL8 determined in culture supernatants (ELISA), as well as levels of IL6 and IL8 mRNA expression (quantitative reverse-transcription PCR, normalized to β-actin level). Data expressed as mean ± SD. *P<0.05; **P<0.01; ***P<0.001. 25 PS, 25 μg/mL PM_2.5+10% CSE; 50 PS, 50 μg/mL PM_2.5+10% CSE; 100 PS, 100 μg/mL PM_2.5+10% CSE; 200 PS, 200 μg/mL PM_2.5+10% CSE.
Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.

Figure 4 PM_2.5 and smoking/CSE exposure upregulated expression of Wnt5a in lungs of mice and 16HBE cells.

Notes: (A–D) Representative immunofluorescence-stained lung sections from control, PM_2.5, smoking, and PM_2.5 + smoking mouse groups, labeled for Wnt5a (red, original magnification 400×, bar 50 μm), using DAPI nuclear counterstain (blue); (E) levels of Wnt5a mRNA expressed in mouse lungs, shown by group (normalized to β-actin level, n=5 mice/group); (F–H) cells left unexposed or variably exposed to PM_2.5, CSE, or PM_2.5 + CSE for 24 hours: Wnt5a transcription (quantitative reverse-transcription PCR; normalized to β-actin level) and protein levels (qualitative and quantitative Western blot, β-actin as loading control). Data expressed as mean ± SD. *P<0.05; **P<0.01; ***P<0.001.
Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.

Figure 5 Wnt5a antagonist downregulated levels of proinflammatory cytokines and Wnt5a.

Notes: (A) Cell viability measured after exposure to BOX5 at various concentrations (100–300 μM). (B–E) Cells pretreated with BOX5 (200 μM) for 1 hour prior to PM_2.5 (100 μg/mL) or 10% CSE exposure for 24 hours: levels of IL6 and IL8 protein in culture supernatants (ELISA), as well as levels of IL6 and IL8 mRNA expression in 16HBE cells (quantitative reverse-transcription PCR; normalized to β-actin level). (F, G) Representative band of Wnt5a on Western blot (β-actin as loading control); (H, I) Quantitative Western blot analysis of Wnt5a. Data expressed as mean ± SD. *P<0.05; **P<0.01; ***P<0.001.
Abbreviation: PM_2.5, particulate matter ≤2.5 μm.

Figure 6 Expression levels of P-ERK1/2 and T-ERK1/2 analyzed by Western blot.

Notes: (A) Mice left unexposed or variably exposed to PM_2.5, smoking, or PM_2.5 + smoking for 10 months (n=5 mice/group); (B) cells left unexposed or variably exposed to PM_2.5 (100 μg/mL), CSE (10%), or PM_2.5 (100 μg/mL) + CSE (10%) for 24 hours; (C, D) cells preincubated with BOX5 (200 μM) or vehicle (PBS) for 1 hour, then exposed or unexposed to PM_2.5/CSE for 24 hours. Data expressed as mean ± SD. *P<0.05; **P<0.01; ***P<0.001.
Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.

Figure S1 PM_2.5 aggravated smoking-induced inflammatory cell infiltration in lungs of mice.

Notes: (A–L) Representative double immunofluorescence–stained lung-tissue sections from control, PM_2.5, smoking, and PM_2.5 + smoking groups, labeled for Ly6G⁺ neutrophils (red, A–D), CD3⁺ T lymphocytes (green, E–H), and composite images (I–L; original magnification 400×, bar 50 μm), using DAPI nuclear counterstain (blue).

Abbreviation: PM_2.5, particulate matter ≤2.5 μm.

Figure S2 PM_2.5 aggravated smoking-induced hyperplasia of alveolar epithelial cells and small-airway epithelia in lungs of mice.

Note: (A–D) Representative immunohistochemistry-stained lung sections from control, PM_2.5, smoking, and PM_2.5 + smoking group, labeled for PCNA (brown, original magnification 200×, bar 50 μm).

Abbreviation: PM_2.5, particulate matter ≤2.5 μm.

Figure S3 Correlation between levels of Wnt5a and inflammatory factors (IL6 and IL8) in mice and 16HBE cells.

Notes: (A, B) Correlation between levels of Wnt5a and IL6/IL8 in mice (n=5 mice/group); (C, D) correlation between levels of Wnt5a and IL6/IL8 in 16HBE cells. Data represent the relative mRNA expressions of Wnt5a and inflammatory factors in mice or cells. Pearson or Spearman analysis was used to calculate correlation (R)- and P-values.

Abbreviations: PM_2.5, particulate matter ≤2.5 μm; 16HBE, 16 human bronchial epithelial cells.

Figure S4 Expression levels of Wnt5a analyzed by Western blot.

Notes: (A, B) Cells preincubated with BOX5 (200 μM) or vehicle (PBS) for 1 hour, then exposed or unexposed to PM_2.5 (100 μg/mL) + CSE (10%) for 24 hours (qualitative and quantitative Western blot, β-actin as loading control). Data expressed as mean ± SD. *P<0.05; **P<0.01.

Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.

Figure S5 Wnt5a in regulation of airway inflammation induced by PM_2.5 and smoking/CSE.

Abbreviations: PM_2.5, particulate matter ≤2.5 μm; CSE, cigarette-smoke extract.