CYP2B6 genetic polymorphisms influence chronic obstructive pulmonary disease susceptibility in the Hainan population

Figures & data

Table 1 Primers used for this study

SNP_ID	2nd PCR	1st PCR	UEP DIR	UEP SEQ
rs12979270	ACGTTGGATGCTGTTGTAGACCACAGTCAC	ACGTTGGATGTGATAGACGGAAGCAGTAGG	F	gCTGCTGTAGTCTTCCCC
rs4803420	ACGTTGGATGTGAAAACATTTGGAGCTAGG	ACGTTGGATGAGCTGGTATCACAGGCGTC	R	ggggaTGACATCAGGAGTTCAAGA
rs2099361	ACGTTGGATGCACAATGGACAATGTCAACG	ACGTTGGATGTTTGTACATCCAGTGGGCTC	F	gtcacCGTAGTTGAGTGATTCTTTAC
rs1038376	ACGTTGGATGCAACATGAAAGCAACCAGAC	ACGTTGGATGTTTAGTAGGGACATGTTGGC	R	caccTTATGCCTGTAATATCAGCACTT
rs4803418	ACGTTGGATGGCAAAGAGAAATTGAGGCAG	ACGTTGGATGTCTCTCTGGTTCTCACTTGC	F	gggcGGCAGAGAAAATTAGAGAGA

Abbreviations: PCR, polymerase chain reaction; UEP, unextended mini-sequencing primer.

Table 2 Characteristics of patients with COPD and the control individuals

Variable (s)	Case, N (%)	Control, N (%)	P-value
	(N=313)	(N=508)
Gender, N (%)			0.004^a
Male	238 (76.0%)	337 (66.3%)
Female	75 (24.0%)	171 (33.7%)
Age, year (mean ± SD)	71.80±10.09	60.05±6.48	<0.001^b
Smoking status, N (%)			0.082^b
Smoking	147 (47.0%)	216 (42.5%)
Non-smoking	164 (52.4%)	292 (57.5%)
BMI, kg/m2	24.67 (±4.62)	24.35 (±4.58)	0.587^b
FEV1/FVC	0.56 (±0.05)	0.79 (±0.04)

Notes: ^aP-values were calculated by two-side chi-squared tests; ^bP-values were calculated from sample’s t-tests; P<0.05 indicates statistical significance.

Abbreviations: BMI, body mass index; FEV1, forced expiratory volume in 1 second; FVC, forced volume capacity.

Table 3 Basic information about candidate SNPs and association with the risk of COPD in allele model

SNP	Chr	Position	Gene (s)	Role	Alleles	Frequency (MAF)		Call rate (%)	p-HWE	OR (95% CI)	P-value
						Cases	Controls
rs2099361	19	40992443	CYP2B6	Intronic	G/T	0.283	0.296	99.40%	0.136	0.94 (0.75–1.17)	0.567
rs4803418	19	41005898	CYP2B6	Intronic	C/G	0.425	0.477	100.00%	0.008	0.81 (0.66–0.99)	0.039
rs4803420	19	41017655	CYP2B6	UTR3	G/T	0.158	0.234	100.00%	0.174	0.61 (0.47–0.80)	2.13E-04*
rs1038376	19	41018104	CYP2B6	UTR3	A/T	0.220	0.124	100.00%	0.152	2.00 (1.53–2.61)	2.38E-07*
rs12979270	19	41018226	CYP2B6	UTR3	A/C	0.313	0.280	98.40%	0.095	1.17 (0.94–1.46)	0.157

Notes: P-values were calculated with Pearson’s χ² tests; *P<0.05 and P values shown in bold are  statistically significant.

Abbreviations: SNP, single-nucleotide polymorphism; Alleles A/B, minor/major alleles; MAF, minor allele frequency; OR, odds ratio; 95% CI, 95% confidence interval; HWE, Hardy–Weinberg equilibrium.

Table 4 Logistic regression analysis of the association between prominent SNPs and COPD risk

SNP	Model	Genotype	Control	Case	Without adjustment		With adjustment
					OR (95% CI)	P-value	OR (95% CI)	P-value
rs2099361	Codominant	A/A	242 (48.1%)	164 (52.7%)	1.00		1.00
		A/C	224 (44.5%)	118 (37.9%)	0.78 (0.58–1.05)	0.098	0.96 (0.66–1.39)	0.810
		C/C	37 (7.4%)	29 (9.3%)	1.16 (0.68–1.96)	0.587	1.12 (0.58–2.13)	0.743
	Dominant	A/A	242 (48.1%)	164 (52.7%)	1.00		1.00
		A/C-C/C	261 (51.9%)	147 (47.2%)	0.83 (0.63–1.10)	0.200	0.98 (0.69–1.40)	0.917
	Recessive	A/A-A/C	466 (92.6%)	282 (90.6%)	1.00		1.00
		C/C	37 (7.4%)	29 (9.3%)	1.30 (0.78–2.15)	0.318	1.14 (0.61–2.13)	0.686
	Log-additive	–	–	–	0.94 (0.75–1.17)	0.564	1.01 (0.77–1.33)	0.924
rs4803420	Co-dominant	G/G	291 (57.5%)	226 (72.2%)	1.00		1.00
		G/T	193 (38.1%)	75 (24.0%)	0.50 (0.36–0.69)	2.01E-05*	0.43 (0.29–0.64)	3.11E-05*
		T/T	22 (4.4%)	12 (3.8%)	0.70 (0.34–1.45)	0.339	0.89 (0.38–2.12)	0.799
	Dominant	G/G	291 (57.5%)	226 (72.2%)	1.00		1.00
		G/T-T/T	215 (42.5%)	87 (27.8%)	0.52 (0.38–0.71)	2.58E-05*	0.47 (0.32–0.69)	9.25E-05*
	Recessive	G/G -G/T	484 (95.6%)	301 (96.2%)	1.00		1.00
		T/T	22 (4.4%)	12 (3.8%)	0.88 (0.43–1.80)	0.720	1.18 (0.50–2.76)	0.706
	Log-additive	–	–	–	0.61 (0.47–0.79)	2.36E-04*	0.59 (0.43–0.82)	0.002*
rs1038376	Co-dominant	A/A	386 (76.0%)	186 (59.4%)	1.00		1.00
		A/T	118 (23.2%)	116 (37.1%)	2.04 (1.50–2.78)	6.68E-06*	2.40 (1.62–3.57)	1.37E-05*
		T/T	4 (0.8%)	11 (3.5%)	5.71 (1.79–18.16)	0.003*	4.35 (0.97–19.63)	0.056
	Dominant	A/A	386 (76.0%)	186 (59.4%)	1.00		1.00
		A/T-T/T	122 (24.0%)	127 (40.6%)	2.16 (1.59–2.93)	6.76E-07*	2.48 (1.68–3.65)	4.35E-06*
	Recessive	A/A-A/T	504 (99.2%)	302 (96.5%)	1.00		1.00
		T/T	4 (0.8%)	11 (3.5%)	4.59 (1.45–14.54)	0.010*	3.38 (0.76–15.05)	0.111
	Log-additive	–	–	–	2.11 (1.59–2.79)	1.78E-07*	2.34 (1.63–3.36)	4.41E-06*
rs12979270	Co-dominant	A/A	249 (50.2%)	142 (46.1%)	1.00		1.00
		A/C	216 (43.6%)	139 (45.1%)	1.13 (0.84–1.52)	0.425	1.09 (0.75–1.58)	0.641
		C/C	31 (6.3%)	27 (8.8%)	1.53 (0.88–2.66)	0.135	1.48 (0.69–3.14)	0.313
	Dominant	A/A	249 (50.2%)	142 (46.1%)	1.00		1.00
		A/C-C/C	247 (49.8%)	166 (53.9%)	1.18 (0.89–1.57)	0.259	1.13 (0.79–1.62)	0.496
	Recessive	A/A-A/C	465 (93.7%)	281 (91.2%)	1.00		1.00
		C/C	31 (6.3%)	27 (8.8%)	1.44 (0.84–2.47)	0.182	1.41 (0.68–2.94)	0.355
	Log-additive	–	–	–	1.19 (0.94–1.49)	0.143	1.15 (0.86–1.54)	0.353

Notes: P-values were calculated by unconditional logistic regression adjusted for age and gender; *P<0.05 and P values shown in bold are statistically significant.

Abbreviations: SNP, single-nucleotide polymorphism; Alleles A/B, minor/major alleles; MAF, minor allele frequency; OR, odds ratio; 95% CI, 95% confidence interval; HWE, Hardy–Weinberg equilibrium.

Table 5 Relationship of prominent SNPs with the COPD risk stratified by gender

SNP	Model	Genotype	Males				Females
			Control	Case	OR (95% CI)	P-value	Control	Case	OR (95% CI)	P-value
rs4803420	Co-dominant	G/G	194 (57.7%)	168 (70.6%)	1.00		97 (57.1%)	58 (77.3%)	1.00
		G/T	129 (38.4%)	61 (25.6%)	0.45 (0.27–0.73)	0.001*	64 (37.7%)	14 (18.7%)	0.36 (0.18–0.74)	0.006*
		T/T	13 (3.9%)	9 (3.8%)	0.95 (0.32–2.85)	0.928	9 (5.3%)	3 (4.0%)	0.74 (0.18–3.06)	0.681
	Dominant	G/G	194 (57.7%)	168 (70.6%)	1.00		97 (57.1%)	58 (77.3%)	1.00
		G/T-T/T	142 (42.3%)	70 (29.4%)	0.49 (0.3–0.78)	0.003*	73 (42.9%)	17 (22.7%)	0.40 (0.21–0.79)	0.008*
	Recessive	G/G -G/T	323 (96.1%)	229 (96.2%)	1.00		161 (94.7%)	72 (96.0%)	1.00
		T/T	13 (3.9%)	9 (3.8%)	1.24 (0.42–3.68)	0.693	9 (5.3%)	3 (4.0%)	1.01 (0.25–4.10)	0.994
	Log-additive	–	–	–	0.61 (0.41–0.91)	0.017*	–	–	0.52 (0.29–0.93)	0.026*
	Allele	T	517 (76.9%)	397 (83.4%)	1.00		258 (75.9%)	130 (96.7%)	1.00
		G	155 (23.1%)	79 (16.6%)	0.66 (0.49–0.90)	0.007*	82 (24.1%)	20 (13.3%)	0.48 (0.28–0.82)	0.008*
rs1038376	Co-dominant	A/A	251 (74.5%)	150 (63.0%)	1.00		135 (79.0%)	36 (48.0%)	1.00
		A/T	83 (24.6%)	78 (32.8%)	1.79 (1.09–2.94)	0.022*	35 (20.5%)	38 (50.7%)	4.32 (2.25–8.32)	1.19E-05*
		T/T	3 (0.9%)	10 (4.2%)	5.30 (0.82–34.32)	0.080	1 (0.6%)	1 (1.3%)	2.30 (0.11–47.29)	0.588
	Dominant	A/A	251 (74.5%)	150 (63.0%)	1.00		135 (79.0%)	36 (48.0%)	1.00
		A/T-T/T	86 (25.5%)	88 (37.0%)	1.91 (1.18–3.10)	0.009*	36 (21.0%)	39 (52.0%)	4.24 (2.22–8.11)	1.25E-05*
	Recessive	A/A-A/T	334 (99.1%)	228 (95.8%)	1.00		170 (99.4%)	74 (98.7%)	1.00
		T/T	3 (0.9%)	10 (4.2%)	4.50 (0.70–28.81)	0.113	1 (0.6%)	1 (1.3%)	1.41 (0.07–28.72)	0.823
	Log-additive	–	–	–	1.89 (1.21–2.94)	0.005*	–	–	3.82 (2.04–7.15)	2.89E-05*
	Allele	A	585 (86.8%)	378 (79.4%)	1.00		305 (89.2%)	110 (73.3%)	1.00
		T	89 (13.2%)	98 (20.6%)	1.70 (1.24–2.34)	0.001*	37 (10.8%)	40 (26.7%)	3.00 (1.82–4.93)	8.43E-06*
rs12979270	Co-dominant	A/A	163 (49.1%)	113 (48.1%)	1.00		86 (52.4%)	29 (39.7%)	1.00
		A/C	148 (44.6%)	104 (44.2%)	0.99 (0.62–1.57)	0.952	68 (41.5%)	35 (480%)	1.41 (0.75–2.67)	0.284
		C/C	21 (6.3%)	18 (7.7%)	0.95 (0.34–2.61)	0.918	10 (6.1%)	9 (12.3%)	2.77 (0.91–8.46)	0.074
	Dominant	A/A	163 (49.1%)	113 (48.1%)	1.00		86 (52.4%)	29 (39.7%)	1.00
		A/C-C/C	169 (50.9%)	122 (51.9%)	0.98 (0.63–1.54)	0.936	78 (47.6%)	44 (60.3%)	1.57 (0.85–2.88)	0.147
	Recessive	A/A-A/C	311 (93.7%)	217 (92.3%)	1.00		154 (93.9%)	64 (87.7%)	1.00
		C/C	21 (6.3%)	18 (7.7%)	0.95 (0.35–2.57)	0.927	10 (6.1%)	9 (12.3%)	2.33 (0.8–6.79)	0.121
	Log-additive	–	–	–	0.98 (0.67–1.43)	0.918	–	–	1.56 (0.97–2.51)	0.069
	Allele	A	474 (71.4%)	330 (70.2%)	1.00		240 (73.2%)	93 (63.7%)	1.00
		C	190 (28.6%)	140 (29.8%)	1.06 (0.82–1.37)	0.691	88 (26.8%)	53 (36.3%)	1.55 (1.03–2.36)	0.039*

Notes: P-values were calculated by unconditional logistic regression analysis with adjustments for age; *P<0.05 and P values shown in bold are statistically significant.

Abbreviations: SNP, single-nucleotide polymorphism; Alleles A/B, minor/major alleles; MAF, minor allele frequency; OR, odds ratio; 95% CI, 95% confidence interval.

Table 6 Relationship between CYP2B6 gene polymorphisms and the risk of COPD stratified by smoking status

SNP	Model	Genotype	Smoking				Non-smoking
			Control	Case	OR (95% CI)	P-value	Control	Case	OR (95% CI)	P-value
rs12979270	Co-dominant	A/A	114 (53.8%)	61 (42.1%)	1.00		135 (47.5%)	81 (50.3%)	1.00
		A/C	88 (41.5%)	70 (48.3%)	1.51 (0.79–2.88)	0.213	128 (45.1%)	67 (41.6%)	0.81 (0.5–1.31)	0.397
		C/C	10 (4.7%)	14 (9.7%)	3.36 (0.84–13.49)	0.088	21 (7.4%)	13 (8.1%)	0.82 (0.31–2.16)	0.687
	Dominant	A/A	114 (53.8%)	61 (42.1%)	1.00		135 (47.5%)	81 (50.3%)	1.00
		A/C-C/C	98 (46.2%)	84 (57.9%)	1.64 (0.88–3.08)	0.121	149 (52.5%)	80 (49.7%)	0.81 (0.51–1.29)	0.383
	Recessive	A/A-A/C	202 (95.3%)	131 (90.3%)	1.00		263 (92.6%)	148 (91.9%)	1.00
		C/C	10 (4.7%)	14 (9.7%)	2.73 (0.71–10.45)	0.144	21 (7.4%)	13 (8.1%)	0.91 (0.35–2.32)	0.837
	Log-additive	–	–	–	1.65 (0.97–2.79)	0.063	–	–	0.86 (0.59–1.25)	0.425
	Allele	A	316 (74.5%)	192 (66.2%)	1.00		398 (70.1%)	229 (71.1%)	1.00
		C	108 (25.5%)	98 (33.8%)	1.49 (1.08–2.07)	0.016*	170 (29.9%)	93 (28.9%)	0.95 (0.7–1.28)	0.742

Notes: P-values were calculated by unconditional logistic regression analysis with adjustments for gender and age; *P<0.05 and P values shown in bold are statistically significant.

Abbreviations: SNP, single-nucleotide polymorphism; Alleles A/B, minor/major alleles; MAF, minor allele frequency; OR, odds ratio; 95% CI, 95% confidence interval.

Table 7 Haplotype frequencies of CYP2B6 gene polymorphisms and the association with COPD risk

	SNP	Haplotype	Freq (Case)	Freq (Control)	Without adjusted		With adjusted
					OR (95% CI)	P-value	OR (95% CI)	P-value
Total	rs4803420|rs1038376|rs12979270	GAC	0.313	0.278	1.20 (0.96–1.51)	0.114	1.17 (0.87–1.58)	0.290
		GTA	0.779	0.873	0.49 (0.37–0.64)	4.93E-07*	0.45 (0.31–0.65)	1.69E-05*
		TAA	0.839	0.764	1.63 (1.25–2.12)	2.97E-04*	1.69 (1.22–2.34)	0.002*
		GAA	0.695	0.642	1.28 (1.03–1.60)	0.026*	1.24 (0.94–1.63)	0.133
Males	rs4803420|rs1038376|rs12979270	GAC	0.298	0.284	1.08 (0.82–1.41)	0.597	1.00 (0.69–1.47)	0.992
		GTA	0.794	0.866	0.59 (0.42–0.81)	0.001*	0.56 (0.35–0.87)	0.011*
		TAA	0.832	0.769	1.50 (1.11–2.04)	0.009*	1.60 (1.06–2.39)	0.024*
		GAA	0.672	0.651	1.10 (0.86–1.42)	0.454	1.00 (0.72–1.39)	0.997
Females	rs4803420|rs1038376|rs12979270	GAC	0.363	0.265	1.62 (1.05–2.49)	0.029*	1.58 (0.98–2.54)	0.060
		GTA	0.733	0.889	0.28 (0.16–0.49)	1.01E-05*	0.27 (0.15–0.52)	5.69E-05*
		TAA	0.863	0.753	2.05 (1.20–3.51)	0.009*	1.99 (1.12–3.54)	0.020*
		GAA	0.767	0.624	2.18 (1.35–3.52)	0.001*	2.15 (1.28–3.62)	0.004*

Notes: Block comprised the three closely linked SNPs rs4803420, rs1038376, and rs12979270; P-values were calculated with Pearson’s χ² tests; *P<0.05 and P values shown in bold are statistically significant.

Abbreviations: OR, odds ratio; 95% CI, 95% confidence interval.

Figure 1 The haplotype block map constructed by candidate SNPs in CYP2B6.

Notes: Block 1 includes rs4803420, rs1038376, and rs12979270; the linkage disequilibrium between two SNPs is indicated by standardized r² (red boxes).

Figure 2 The haplotype block diagram constructed by candidate SNPs in CYP2B6 in males.

Notes: Block 1 includes rs4803420, rs1038376, and rs12979270; the linkage disequilibrium between two SNPs is indicated by standardized r² (red boxes).

Figure 3 The haplotype block diagram constructed by candidate SNPs in CYP2B6 in females.

Notes: Block 1 includes rs4803420, rs1038376, and rs12979270; the linkage disequilibrium between two SNPs is indicated by standardized r² (red boxes).

Table S1 SNP functional annotation in HaploReg v4.1 database

SNP	Chr	Role	Gene (s)	HaploReg
rs2099361	19	Intronic	CYP2B6	Promoter histone marks, Enhancer histone marks, Motifs changed
rs4803420	19	UTR3	CYP2B6	Motifs changed
rs1038376	19	UTR3	CYP2B6	DNAse, Motifs changed, GRASP QTL hits
rs12979270	19	UTR3	CYP2B6	Enhancer histone marks, DNAse, Motifs changed

Abbreviations: SNP, single-nucleotide polymorphism; Ref, reference; Alt, alternation; eDTL, expression quantitative trait loci.