The Predictive Value of microRNA-134 and microRNA-1233 for the Early Diagnosis of Acute Exacerbation of Chronic Obstructive Pulmonary Disease with Acute Pulmonary Embolism

Figures & data

Table 1 miRNA Related Sequences

Gene Name	Mature miRNA Sequence	miRBase Accession Number	Stem-Loop Sequence
hsa-miR-1233-5p	AGUGGGAGGCCAGGGCACGGCA	MIMAT022943	GUGAGUGGGAGGCCAGGGCACGGCAGGGGGAGCUGCAGGGCUAUGGGAGGGGCCCCAGCGUCUGAGCCCUGUCCUCCCGCAG
hsa-miR-134-3p	CCUGUGGGCCACCUAGUCACCAA	MIMAT026481	CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUAGUCACCAACCCUC
cel-miR-39	UCACCGGGUGUAAAUCAGCUUG	MIMAT000010	UAUACCGAGAGCCCAGCUGAUUUCGUCUUGGUAAUAAGCUCGUCAUUGAGAUUAUCACCGGGUGUAAAUCAGCUUGGCUCUGGUGUC

Table 2 Characteristics of Individuals Enrolled in the Study

Projects	AECOPD (n=39)	AECOPD+APE Group (n=13)	Stable COPD (n=10)	X^2/t	p
Age (years)[ (S)]	76.34(8.38)	79.89(7.75)	77.34 (6.57)	−0.647	0.525
Dyspnea [n(%)]	33(78.57)	12(92.31)	/	−2.629	0.012
Cough [n(%)]	34(80.95)	11(84.62)	/	0.218	0.829
Chest pain [n(%)]	2(4.76)	0	/	1.433	0.16
Hemoptysis [n(%)]	1(2.38)	2(15.38)	/	−1.733	0.089
Smoking [n(%)]	2(4.76)	8(61.54)	/	0.985	0.338
History of Stroke [n(%)]	30(71.42)	4(30.77)	/	−1.213	0.231
Pulmonary heart disease [n(%)]	4 (9.52)	0	/	−1.166	0.249
Diabetes [n(%)]	4 (9.52)	4 (30.77)	/	0.281	0.781
Hypertension [n(%)]	19 (45.23)	8 (61.54)	/	−0.791	0.438
History of surgery within 6 weeks [n(%)]	0	1(7.70)	/	−1.768	0.083
Prolonged immobility ≥3 days [n(%)]	0	3(23.08)	/	−3.354	0.002
Malignant Tumor [n(%)]	2(2.38)	0	/	1.433	0.16

Abbreviations: AECOPD, acute exacerbation of chronic obstructive pulmonary disease; APE, acute pulmonary embolism; COPD, chronic obstructive pulmonary disease.

Table 3 Comparison of Laboratory Test Data Between the Two Groups [ (S)]

Project	AECOPD (n=42)	AECOPD+APE (n=13)	t	P
PH	7.42±0.17	7.39±0.11	0.64	0.527
PaCO2(kPa)	6.34±1.94	5.89±0.73	0.805	0.425
PaO2(kPa)	11.38±4.55	9.87±3.81	1.179	0.25
D-dimer (mg/l)	0.55±0.63	2.46±3.27	−3.512	0.001
Fbg(pg/l)	4.74±0.13	4.39±0.24	−0.528	0.604
NT-proBNP(pf/mL)	1088.79±318.23	1638.08±572.18	−0.839	0.411
WBC(×10^9/l)	10.25±5.17	10.59±4.94	−0.21	0.835
CRP(mg/l)	43.99±7.49	59.69±18.99	−0.72	0.482

Abbreviations: PH, potential of hydrogen; PCO₂, partial pressure of carbon dioxide; PO₂, arterial partial pressure of oxygen; Fbg, fibrinogen; NT-proBNP, N-terminal B-type natriuretic peptide; WBC, leukocyte; CRP, C-Reactive protein; AECOPD, acute exacerbation of chronic obstructive pulmonary disease; APE, acute pulmonary embolism; COPD, chronic obstructive pulmonary disease.

Figure 1 Expression level of miR-1233 (A) and miR-134 (B) in serum of 13 AECOPD+APE patients and matched AECOPD and COPD controls.

Abbreviations: AECOPD, acute exacerbation of chronic obstructive pulmonary disease; APE, pulmonary embolism; COPD, chronic obstructive pulmonary disease.

Figure 2 Receiver-operating characteristic (ROC) curve analysis of serum miR-1233, miR-134, plasma D-dimer to discriminate AECOPD+APE patients from AECOPD controls. (A) The analysis showed that the receiver operating characteristic (ROC) area under the curve (AUC) for miR-1233 was 0.884 (95% CI 0.79–0.978)(P<0.05), the AUC for miR-134 was 0.931 (95% CI 0.863–0.999)(P<0.05); (B) the AUC for D-dimer was 0.628 (95% CI 0.447–0.809), the AUC for age-adjusted plasma D-dimer was 0.705 (95% CI 0.525–0.885), and the AUC for Wells score was 0.577 (95% CI 0.389–0.765).

Figure 3 Receiver-operating characteristic (ROC) curve analysis of serum miR-1233, miR-134 combined with plasma D-dimer and Wells score to discriminate AECOPD+APE patients from AECOPD controls. (A) The area under the ROC curve (AUC) of miR-1233 combined with miR-134 was 0.957 (95% CI 0.908–1.000 P<0.05); (B) the AUC for miR-1233+D-dimer was 0.88 (95% CI 0.783–0.977 P<0.05); the AUC for miR-134+D-dimer was 0.936 (95% CI 0.87–1.000, P<0.05); the AUC for D-dimer+Wells was 0.684 (95% CI 0.492–0.876, P<0.05); the AUC for miR-1233+D-dimer+Wells was 0.908 (95% CI 0.815–1.000, P<0.05); the miR-134+D-dimer+Wells was 0.947 (95% CI 0.884–1.000, P<0.05).

Figure 4 Receiver-operating characteristic (ROC) curve analysis of serum miR-1233, miR-134 combined with age-adjusted plasma D-dimer and Wells score. The area under the ROC curve (AUC) of miR-1233 combined with age-adjusted D-dimer was 0.897 (95% CI 0.81–0.985, P<0.05); the AUC for miR-134+age-adjusted D-dimer was 0.940 (95% CI 0.878–1.000 P<0.05); the AUC for age-adjusted D-dimer+Wells was 0.717 (95% CI 0.521–0.913 P<0.05); the AUC for miR-1233+age-adjusted D-diemer+Wells was 0.912 (95% CI 0.821–1.000 P<0.05); the AUC for miR-134+age-adjusted D-dimer+Wells was 0.942 (95% CI 0.881–1.000 P<0.05).