Investigation of Pneumocystis jirovecii colonization in patients with chronic pulmonary diseases in the People’s Republic of China

Figures & data

Table 1 Primers and their sequences used in LAMP

Primers	Sequences (5′–3′)
F3	ATCAGATACCGTCGTAGTCTTA
B3	GCTCTCAATCTGTCAATCCTTA
FIP	TTCAGCCTTGCGACCATACTCCTCGCTCGGCATCTTATG
BIP	AAGGGCACCACCAGGAGTTATGTCTGGACCTGGTGAG
Loop F	GGAACCCGAAGACTTTGATTTC
Loop B	TGCGGCTTAATTTGACTCAAC

Abbreviation: LAMP, loop-mediated isothermal amplification.

Table 2 Pneumocystis jirovecii colonization in patients with chronic lung diseases

Disease	Positive	Total	Positive rate (%)
COPD	25	47	53.2*
Acute stage (AECOPD)	10	15	66.7∇
Stable stage	15	32	46.9
ILDs	18	25	72.0
Idiopathic pulmonary fibrosis	3	5	60.0
Fibrosing lung disease associated with connective tissue disease	4	5	80.0
Sarcoidosis	2	3	66.7
Cryptogenic organizing pneumonia	6	8	75.0
Diffuse alveolar hemorrhage	3	4	75.0
CF	14	18	77.8
CB	5	8	62.5
Total	62	98	63.3

Note:

* Compared with ILDs, CF, and CB, P>0.05;

∇ Compared with stable stage, P>0.05.

Abbreviations: AECOPD, acute exacerbations of COPD; ILDs, interstitial lung diseases; CF, cystic fibrosis; CB, chronic bronchiectasis.

Figure 1 Sensitivity of LAMP method compared with PCR.

Notes: Detection limit of LAMP or PCR assays were performed using serial tenfold dilutions of the Pneumocystis plasmid. (A) LAMP method: line 1, ×10⁹ copies/mL; line 2, ×10⁸ copies/mL; line 3, ×10⁷ copies/mL; line 4, ×10⁶ copies/mL; line 5, ×10⁵ copies/mL; line 6, ×10⁴ copies/mL; line 7, ×10³ copies/mL; line 8, ×10² copies/mL; line 9, 50 copies/mL; line 10, 10 copies/mL. (B) PCR method: lane M, 100 bp DNA marker; lane 1, ×10⁹ copies/mL; lane 2, ×10⁸ copies/mL; lane 3, ×10⁷ copies/mL; lane 4, ×10⁶ copies/mL; lane 5, ×10⁵ copies/mL; lane 6, ×10⁴ copies/mL; lane 7, ×10³ copies/mL; lane 8, ×10² copies/mL; lane 9, 50 copies/mL; lane 10, 10 copies/mL.

Abbreviations: LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction.

Figure 2 Examination of the products of LAMP for detecting the Pneumocystis jirovecii gene.

Notes: The products of LAMP were examined by three methods. (A) By real-time turbidity; (B) by either the naked eye or ultraviolet light after adding SYBR Green I; (C) by gel electrophoresis. (A and B) 1, lung of PCP positive rat; 2, sputum specimen of patient; 3, lung of PCP negative rat. (C) Lane M, 2,000 bp DNA marker; lane 1, lung of PCP positive rat; lane 2 and lane 3, sputum specimen of patients; lane 4, lung of PCP negative rat.
Abbreviations: LAMP, loop-mediated isothermal amplification; PCP, Pneumocystis pneumonia.

Table 3 Microbes co-infection in 62 Pneumocystis jirovecii positive patients

Microorganism	Positive	Total	Positive rate (%)
Porphyromonas gingivalis	10	16	62.5
Fusobacterium nucleatum	15	22	68.2
Actinobacillus actinomycetem	2	3	66.7
Tannerella forsythia	5	9	55.6
Treponema pallidum	5	13	38.5
Acinetobacter baumannii	6	7	85.7
Fungi	8	10	80.0
Other bacteria	11	18	66.8
Total	62	98	63.3

Note: There were no statistically significant in difference microbe co-infection with Pneumocystis colonization (P>0.05).

Table 4 Microbe infection in the patients with difference pulmonary diseases subpopulation

Disease	Infective microbes
	P.g	F.n	A.a	T.f	T.p	A.b	Fungi	Other bacteria	Total
COPD	4	7	–	2	2	4	6	6	31
ILDs	3	5	–	–	1	2	1	4	16
CF	2	3	1	2	1	–	1	1	11
CB	1	–	1	1	1	–	–	–	4
Total	10	15	2	5	5	6	8	11	62

Note: There were no statistically significant between infective microbes in difference pulmonary diseases subpopulation (P>0.05).

Abbreviations: A.a, Actinobacillus actinomycetem; A.b, Acinetobacter baumannii; CB, chronic bronchiectasis; CF, cystic fibrosis; F.n, Fusobacterium nucleatum; ILDs, interstitial lung diseases; P.g, Porphyromonas gingivalis; T.f, Tannerella forsythia; T.p, Treponema pallidum.

Table 5 Pneumocystis colonization in patients with different CD4⁺ T-cells

CD4^+ T-cells/mm^3	Positive	Total	Positive rate (%)
<410	20	25	80.0*
>410	42	73	57.5

Note:

* Compared with the patients with CD4⁺ T lymphocyte counts >410/mm³, P<0.05.