Association between vitamin D receptor polymorphisms and osteoporosis in patients with COPD

Figures & data

Table 1 Basic characteristics of the study group (n=200)

	Normal BMD (n=47)	Osteopenia (n=98)	Osteoporosis (n=55)	P-value
				Osteoporosis vs nonosteoporosisa	Osteoporosis vs normal BMD
Sex
Male	46 (97.9%)	89 (90.8%)	45 (81.8%)	0.031	0.010
Female	1 (2.1%)	9 (9.2%)	10 (18.2%)
Age (years)	73 (70–75)	72.0 (68.0–77.0)	74.0 (69.0–78.0)	0.228	0.429
BMI (kg/m^2)	24.4 (21.9–26.9)	23.0 (20.7–25.5)	20.6 (19.0–23.2)	<0.001	<0.001
Smoking
Current	14 (29.8%)	24 (24.5%)	14 (25.5%)	0.321	0.293
Ex	30 (63.8%)	64 (65.3%)	32 (58.2%)
Never	3 (6.4%)	10 (10.2%)	9 (16.4%)
Pack-years	37.0 (20.0–52.0)	26.5 (12.8–48.0)	36.0 (15.0–54.0)	0.601	0.732
Alcohol
Yes	37 (78.7%)	68 (69.4%)	25 (45.5%)	<0.001	0.001
No	10 (21.3%)	30 (30.6%)	30 (54.5%)
Cumulative alcohol (kg)b	165.2 (23.7–428.0)	86.6 (0–319.7)	0.0 (0–115.1)	<0.001	<0.001
Steroid use
Yes	25 (53.2%)	64 (65.3%)	41 (74.5%)	0.097	0.037
No	22 (46.8%)	34 (34.7%)	14 (25.5%)
Cumulative oral or IV (mg)c	0.0 (0–40.0)	0.0 (0–200.4)	0.0 (0–560.0)	0.052	0.028
Cumulative inhaled (mg)d	0.0 (0–671.6)	74.7 (0–850.8)	150.0 (0–1,490.4)	0.040	0.031
Pulmonary function test
FEV1 (% predicted)	83.2±21.1	77.1±20.8	68.0±21.7	0.001	0.001
FVC (% predicted)	97.3±20.1	95.7±17.1	93.7±17.6	0.371	0.340
FEV1/FVC (%)	57.2±7.9	53.8±9.9	48.8±13.1	<0.001	<0.001
Bone metabolic markers
Calcium (mg/dL)	9.1±0.6	9.2±0.6	9.0±0.6	0.069	0.302
Phosphorus (mg/dL)	3.5±0.7	3.2±0.7	3.3±0.5	0.851	0.144
ALP (U/L)	204.0 (161.0–254.0)	232.5 (190.8–289.5)	272.0 (204.5–311.3)	0.003	<0.001
25(OH)D (nmol/L)	14.2 (9.7–19.2)	11.7 (8.5–17.3)	9.6 (7.1–15.0)	0.013	0.003
PTH (pmol/L)	25.2 (19.6–31.0)	25.6 (18.6–35.1)	29.8 (22.4–42.5)	0.061	0.081

Notes: Data represent the mean ± SD, median (IQR) or n (%). P-values shown in bold are significant at the 0.05 level.

a Nonosteoporosis group = normal BMD + osteopenia group.

b Cumulative alcohol dose was calculated with alcohol degree converter.

c Cumulative oral or intravenous steroid dose were combined with prednisolone equivalent dosage.

d Cumulative inhaled steroid dose was calculated with budesonide equivalent dosage.

Abbreviations: BMD, bone mineral density; BMI, body mass index; IQR, interquartile range; IV, intravenous; FEV₁, forced expiratory volume in 1 second; FVC, forced vital capacity; ALP, alkaline phosphatase; 25(OH)D, 25-hydroxyvitamin D; PTH, parathyroid hormone.

Table 2 Association of VDR allele frequencies and genotypes with osteoporosis in patients with COPD

Polymorphism	Genotype			MAF	Subgroup comparison	P-value
						Additive	Dominant	Recessive	MAF
rs1544410	AA	AG	GG		Osteoporosis vs nonosteoporosis*	0.772	NA	0.772	0.776
Normal BMD	0 (0.0%)	5 (10.6%)	42 (89.4%)	0.053
Osteopenia	0 (0.0%)	6 (6.1%)	92 (93.9%)	0.031	Osteoporosis vs normal BMD	1.000	NA	1.000	1.000
Osteoporosis	0 (0.0%)	5 (9.1%)	50 (90.9%)	0.045
rs7975232	AA	AC	CC		Osteoporosis vs nonosteoporosis*	0.081	0.193	0.075	0.041
Normal BMD	4 (8.5%)	19 (40.4%)	24 (51.1%)	0.287
Osteopenia	3 (3.1%)	37 (37.8%)	58 (59.2%)	0.219	Osteoporosis vs normal BMD	0.026	0.042	0.044	0.016
Osteoporosis	0 (0/0%)	16 (29.1%)	39 (70.9%)	0.145
rs731236	TT	TC	CC		Osteoporosis vs nonosteoporosis*	0.814	1.000	1.000	1.000
Normal BMD	42 (89.4%)	5 (10.6%)	0 (0.0%)	0.053
Osteopenia	90 (91.8%)	7 (7.1%)	1 (1.0%)	0.046	Osteoporosis vs normal BMD	1.000	NA	1.000	1.000
Osteoporosis	50 (90.95%)	5 (9.1%)	0 (0.0%)	0.045
rs10735810	CC	CT	TT		Osteoporosis vs nonosteoporosis*	0.949	0.823	1.000	0.821
Normal BMD	14 (29.8%)	25 (53.2%)	8 (17.0%)	0.436
Osteopenia	32 (32.7%)	53 (54.1%)	13 (13.3%)	0.403	Osteoporosis vs normal BMD	0.820	0.585	0.832	0.670
Osteoporosis	18 (32.7%)	30 (54.5%)	7 (12.7%)	0.400

Notes:

* Nonosteoporosis group = normal BMD + osteopenia group. P-values shown in bold are significant at the 0.05 level.

Abbreviations: VDR, vitamin D receptor; BMD, bone mineral density; MAF, minor allele frequency.

Table 3 Association of haplotype frequencies and genotypes with osteoporosis in patients with COPD

Haplotypes	Genotype			Haplotype frequency	Subgroup comparison	P-value
						Additive	Dominant	Recessive	Haplotype frequency
GCT	GCT/GCT	GCT/−	−/−		Osteoporosis vs nonosteoporosis*	0.063	0.110	0.055	0.030
Normal BMD	24 (51.1%)	19 (40.4%)	4 (8.5%)	67 (71.3%)
Osteopenia	57 (58.2%)	37 (37.8%)	4 (4.1%)	151 (77.0%)	Osteoporosis vs normal BMD	0.027	0.042	0.044	0.016
Osteoporosis	39 (70.9%)	16 (29.1%)	0 (0.0%)	94 (85.5%)
GAT	GAT/GAT	GAT/−	−/−		Osteoporosis vs nonosteoporosis*	0.054	0.028	0.325	0.018
Normal BMD	2 (4.3%)	18 (38.3%)	27 (57.4%)	22 (23.4%)
Osteopenia	3 (3.1%)	30 (30.6%)	65 (66.3%)	36 (18.4%)	Osteoporosis vs normal BMD	0.028	0.018	0.210	0.013
Osteoporosis	0 (0.0%)	11 (20.0%)	44 (80.0%)	11 (10.0%)
AAC	AAC/AAC	AAC/−	−/−		Osteoporosis vs nonosteoporosis*	0.772	0.772	NA	0.776
Normal BMD	0 (0.0%)	5 (10.6%)	42 (89.4%)	5 (5.3%)
Osteopenia	0 (0.0%)	6 (6.1%)	92 (93.9%)	6 (3.1%)	Osteoporosis vs normal BMD	1.000	1.000	NA	1.000
Osteoporosis	0 (0.0%)	5 (9.1%)	50 (90.9%)	5 (4.5%)

Notes: SNPs in haplotypes are in order of rs1544410, rs7975232, and rs731236.

* Nonosteoporosis group = normal BMD + osteopenia group. P-values shown in bold are significant at the 0.05 level.

Abbreviations: BMD, bone mineral density; SNPs, single-nucleotide polymorphisms.

Table 4 Multivariate logistic regression analysis for the GAT dominant type in patients with COPD (n=200)

Variables	Univariate analysis		Multivariate analysis
	OR (95% CI)	P-value	OR	P-value
BMI (kg/m^2)	0.748 (0.661–0.845)	<0.001	0.739 (0.648–0.842)	<0.001
Cumulative alcohol (kg)a	0.998 (0.997–1.000)	0.018	0.998 (0.997–1.000)	0.009
FEV1 (% predicted)	0.975 (0.960–0.991)	0.002	0.974 (0.956–0.993)	0.006
Not carrying GAT haplotypeb	2.304 (1.097–4.840)	0.027	2.783 (1.196–6.476)	0.018

Notes:

a Cumulative alcohol dose was calculated with alcohol degree converter.

b Reference = GAT/GAT or GAT/−. P-values shown in bold are significant at the 0.05 level.

Abbreviations: BMI, body mass index; CI, confidence interval; FEV₁, forced expiratory volume in 1 second; OR, odds ratio.

Table S1 Primers of vitamin D receptor (VDR) polymorphisms

Name of gene	Sequence of primer
rs1544410	Forward: TACTTTGCTGGTTTGCAGAGCC Reverse: CTTTGGACCTCATCACCGACA
rs7975232	Forward: TCTGGATCATCTTGGCATAGAG Reverse: TAGCAGAGCAGAGTTCCAAGC
rs731236	Forward: TCTGGATCCTAAATGCACGGAG Reverse: AGTCAGGAGATCTCATTGCCAA
rs10735810	Forward: CATCTGAAACCAGGCAGCTGA Reverse: TGTGGCTGTGAGCGCCGCAT

Table S2 Association of VDR genotypes and bone mineral density (T-score) in patients with COPD

	Additive			P-value	Dominant		P-value	Recessive		P-value
rs1544410	AA (n=0)	AG (n=16)	GG (n=184)
Femoral neck	NR	−1.4±1.3	−1.3±1.1	0.655	NA	NA	NA	NA	NA	NA
L-spine	NR	−1.5±1.4	−1.3±1.7	0.571	NA	NA	NA	NA	NA	NA
rs7975232	AA (n=7)	AC (n=72)	CC (n=121)		AC + CC (n=193)	AA (n=7)		CC (n=121)	AA + AC (n=79)
Femoral neck	−0.7±1.2	−1.2±1	−1.4±1.2	0.184	−1.3±1.1	−0.7±1.2	0.119	−1.4±1.2	−1.2±1.0	0.189
L-spine	−0.4±0.8	−1.2±1.9	−1.4±1.5	0.220	−1.4±1.7	−0.4±0.8	0.399	−1.4±1.5	−1.1±1.8	0.215
rs731236	TT (n=182)	TC (n=17)	CC (n=1)		TT + TC (n=199)	CC (n=1)		TT (n=182)	TC + CC (n=18)
Femoral neck	−1.3±1.1	−1.4±1.3	−0.7	0.801	−1.3±1.1	−0.7	0.580	−1.3±1.1	−1.3±1.3	0.812
L-spine	−1.3±1.7	−1.5±1.4	−1.8	0.879	−1.3±1.7	−1.8	0.771	−1.3±1.7	−1.5±1.4	0.638
rs10735810	CC (n=64)	CT (n=108)	TT (n=28)		CC + CT (n=172)	TT (n=28)		CC (n=64)	CT + TT (n=136)
Femoral neck	−1.2±1.2	−1.4±1.1	−1.3±1.1	0.637	−1.3±1.1	−1.3±1.1	0.739	−1.2±1.2	−1.4±1.1	0.446
L-spine	−1.4±1.6	−1.4±1.7	−1.0±1.6	0.541	−1.4±1.7	−1.0±1.6	0.275	−1.4±1.6	−1.3±1.7	0.624

Note: Data represent the mean ± SD.

Abbreviations: L-spine, lumbar spine 1–4; NA, not applicable; NR, no result; VDR, vitamin D receptor.

Table S3 Association of haplotype genotypes and BMD (T-score) in patients with COPD

	Additive			P-value	Dominant		P-value	Recessive		P-value
GCT	GCT/GCT (n=120)	GCT/− (n=72)	−/− (n=8)		GCT/GCT + GCT/− (n=192)	−/− (n=8)		GCT/GCT (n=120)	GCT/− + −/− (n=80)
Femoral neck	−1.4±1.2	−1.2±1.0	−0.7±1.1	0.151	−1.4±1.1	−0.7±1.1	0.096	−1.4±1.2	−1.2±1.0	0.165
L-spine	−1.4±1.5	−1.2±1.9	−0.6±0.9	0.293	−1.4±1.7	−0.6±0.9	0.200	−1.4±1.5	−1.1±1.8	0.232
GAT	GAT/GAT (n=5)	GAT/− (n=59)	−/− (n=136)		GAT/GAT + GAT/− (n=64)	−/− (n=136)		GAT/GAT (n=5)	GAT/− +−/− (n=195)
Femoral neck	−1.1±1.1	−1.1±0.9	−1.4±1.2	0.123	−1.1±0.9	−1.4±1.2	0.040	−1.1±1.1	−1.3±1.1	0.597
L-spine	−0.4±0.8	−1.1±2.0	−1.5±1.5	0.161	−1.0±1.9	−1.5±1.5	0.085	−0.4±0.8	−1.3±1.7	0.228
AAC	AAC/AAC (n=0)	AAC/− (n=16)	−/− (n=184)
Femoral neck	NR	−1.4±1.3	−1.3±1.1	0.655	NA	NA	NA	NA	NA	NA
L-spine	NR	−1.5±1.4	−1.3±1.7	0.572	NA	NA	NA	NA	NA	NA

Notes: SNPs in haplotypes are in order of rs1544410, rs7975232 and rs731236. Data represent the mean ± SD. P-values shown in bold are significant at the 0.05 level.

Abbreviations: BMD, bone mineral density; L-spine, lumbar spine 1–4; NA, not applicable; NR, no result; SNPs, single-nucleotide polymorphisms.