Chondroprotective Mechanism of Eucommia ulmoides Oliv.-Glycyrrhiza uralensis Fisch. Couplet Medicines in Knee Osteoarthritis via Experimental Study and Network Pharmacology Analysis

Figures & data

Table 1 Primer Sequences for Quantitative Real-Time PCR

Gene Name	Forward Primers (5’-3’)	Reverse Primers (5’-3’)
Col2a1	GCTGGTGAAGAAGGCAAACGAG	CCATCTTGACCTGGGAATCCAC
Mmp13	GATGACCTGTCTGAGGAAGACC	GCATTTCTCGGAGCCTGTCAAC
Aggrecan	CAGGCTATGAGCAGTGTGATGC	GCTGCTGTCTTTGTCACCCACA
Adamts5	CTGCCTTCAAGGCAAATGTGTGG	CAATGGCGGTAGGCAAACTGCA
Pparg	GTACTGTCGGTTTCAGAAGTGCC	ATCTCCGCCAACAGCTTCTCCT
β-actin	CATTGCTGACAGGATGCAGAAGG	TGCTGGAAGGTGGACAGTGAGG

Table 2 The Detailed Information of Active Ingredients Contained in E.G

Component Name	Chemical Formula	Observation Retention Time (Min)	Molecular Mass Number (Da)	Observed m/z	Detector Count	Response Value	Additives
Aucubin	C15H22O9	1.55	346.12638	369.1151	4951	3994	+Na, +K
Geniposidic acid	C16H22O10	2.84	374.1213	397.1099	66,645	7287	+Na, +H
(+)-Pinoresinol-di-O-β-D-glucoside	C32H42O16	6.72	682.24729	705.2369	136,238	11,100	+Na, +H, +K
Pinocembrin	C15H12O4	7.7	256.07356	257.0808	928,235	666,919	+H
Naringenin	C15H12O5	8.81	272.06847	273.0747	19,411	15,765	+H
Liquiritin	C21H22O9	9.7	418.12638	419.1335	151,886	114,597	+H, +Na
Liquiritigenin	C15H12O4	10.25	256.07356	257.0797	84,205	67,748	+H
Isoglabrolide	C30H44O4	12.55	468.32396	469.3313	740,402	511,085	+H
Licorice-saponin G2	C42H62O17	13.37	838.3987	839.4086	3,490,036	1,777,493	+H, +Na, +K
Glycyrol	C21H18O6	14.59	366.11034	367.1163	7856	1011	+H
Kaempferol	C15H10O6	16.45	286.04774	287.0546	2647	2270	+H
Semilicoisoflavone B	C20H16O6	18.51	352.09469	353.1013	113,861	91,064	+H
Beta-Glycyrrhetinic acid	C30H46O4	21.95	470.33961	471.3468	647,536	459,245	+H, +Na
Cyclopamine	C27H41NO2	27.59	411.31373	412.3207	107,425	18,648	+H, +Na
Coniferin	C16H22O8	34.22	342.13147	365.1222	13,582	13,582	+Na

Figure 1 The total ion chromatogram of E.G in positive ion modes.

Figure 2 E.G decelerated the KOA progression in DMM-induced osteoarthritic mice. (A) ABH staining and TB staining of the right knee joint in C57BL/6 mice (surgical one). Morphological quantitative analysis of (B) area of tibial cartilage (mm²) and (C) thickness of tibial cartilage (μm). (D) OARSI scoring of the sections analyzed by histomorphometry. (E) Representative 3D reconstruction of the right knee joint and subchondral bone. Scale bar=100 μm. (F) BV/TV (%) and (G) Tb.Th (mm) were quantitative analysis data of the subchondral bone. All data were taken as means ± standard deviations (n=6). The corresponding graph provided the exact P value.

Figure 3 E.G alleviated behavioural pathological changes and pain in the DMM-induced KOA mice. (A) Swing (S), (B) Stride length (cm), (C) Paw area (cm²) of the right hind limb and (D) hot plate reaction time (S) of mice were detected. All data were taken as means ± standard deviations (n=6). The corresponding graph provided the exact P value.

Figure 4 E.G inhibited degradation of extracellular matrix in osteoarthritic articular cartilage. (A) Immunohistochemical staining of MMP13, Col2 and Aggrecan in cartilage. Scale bar=100 μm. (B–D) Quantification of the positive repression area of Col2 (mm²), Percentage of positive expression of MMP13 (%) and Aggrecan (%). (E–H) Relative mRNA expression of Col2, Mmp13, Aggrecan and Adamts5 of IL-1β-induced primary mice chondrocytes treated with EGS. All data were taken as means ± standard deviations (n=6). The corresponding graph provided the exact P value.

Figure 5 Network pharmacology and molecular docking analysis. (A) KOA’s disease target overlaps between the GeneCards, OMIM, PharmGkb, TTD and Drugbank database. (B) Overlaps between KOA’s targets and E.G drug targets. (C) PPI network and (D) core target screening. (E) E.G-target-KOA network. The circular node represents the traditional Chinese medicine component, the rectangular node represents the disease target, and the arrow node represents the common component of the two drugs. (F) GO enrichment analysis and (G) KEGG pathways enrichment analysis. (H) Molecular docking revealed the binding of beta-Glycyrrhetinic acid, syringetin, (+)-Pinoresinol-di-O-β-D-glucoside and semilicoisoflavone to PPARG protein.

Figure 6 E.G regulated the synthesis and catabolism of chondrocytes in a PPARG-dependent manner. (A) Immunohistochemical staining of PPARG in cartilage. Scale bar=100 μm. (B) Quantification of the percentage of positive expression of PPARG (%). (C) Relative mRNA expression of PPARG in IL-1β-induced primary chondrocytes treated with EGS. (D) The transfection efficiency of siPPARG. (E–H) The mRNA expression of Col2, Aggrecan, MMP13, Adamts5. The primary mice chondrocytes were transfected for 48h and then treated with drug-containing serum for 24h. All data were taken as means ± standard deviations (n=6). The corresponding graph provided the exact P value.