Paeonia lactiflora Pall. protects against ANIT-induced cholestasis by activating Nrf2 via PI3K/Akt signaling pathway

Figures & data

Figure 1 Work flow of present study.

Abbreviations: PLP, Paeonia lactiflora Pall.; LC–MS, liquid chromatography–mass spectrometry; Nrf2, NF-E2-related factor 2; ANIT, alpha-naphthylisothiocyanate; PI3K, phosphatidylinositol 3-kinase.

Table 1 Primers sequences for RT-PCR

Gene	Sense primer (5′–3′)	Antisense primer (5′–3′)
GCLc	TCTGGATGATGCCAACGAGTC	CCTGGTCAGCAGTACCACAAATA
GCLm	TGATGCCACCAGATTTGACTGC	CTGCTTTTCACGATGACCGAGT
Akt	ATCGTGTGGCAAGATGTGTATGA	CAAAATACCTGGTGTCGGTCTCA
Nqo1	GCGGTGAGAAGAGCCCTGAT	GCTCCCCTGTGATGTCGTTTC
HO-1	CAGGGTGACAGAAGAGGCTAAG	CTGTGAGGGACTCTGGTCTTTG
Nrf2	CAAACATTCAAGCCGATTAGAGG	CGGCAACTTTATTCTTCCCTCT
β-actin	TGCTATGTTGCCCTAGACTTCG	GTTGGCATAGAGGTCTTTACGG

Abbreviation: RT-PCR, reverse transcription polymerase chain reaction.

Table 2 Identification of compounds present in PLP by UHPLC-Q-TOF

tR (minutes)	Negative ion mode (m/z)	Positive ion mode (m/z)	Chemical formula	Assigned identification
4.560	531.12 [M+Cl]^−	519.14 [M+Na]^+	C23H28O12	Oxypaeoniflorin
6.370	515.13 [M+Cl]^−	481.17 [M+H]^+, 503.15 [M+Na]^+	C23H28O11	Albiflorin
6.968	515.13 [M+Cl]^−	503.15 [M+Na]^+	C23H28O11	Paeoniflorin
14.325	619.15 [M+Cl]^−	607.17 [M+Na]^+	C30H32O12	Benzoylpaeoniflorin

Notes: [M+Cl]⁻, ionized form as negative ion of molecule with Cl⁻; [M+Na]⁺, ionized form as positive ion of molecule with Na⁺; [M+H]⁺, ionized form as positive ion of molecule with H⁺.

Abbreviations: PLP, Paeonia lactiflora Pall.; UHPLC-Q-TOF, ultra high performance liquid chromatography-quadruple-time of flight; t_R, retention time; m/z, mass to charge ratio.

Figure 2 Positive ES mode of LC–MS of PLP aqueous extract.

Notes: Four major compounds were identified. The sequence of t_R was oxypaeoniflorin, albiflorin, paeoniflorin, and benzoylpaeoniflorin.
Abbreviations: ES, electron spray; PLP, Paeonia lactiflora Pall.; LC–MS, liquid chromatography–mass spectrometry; t_R, retention time.

Figure 3 Effects of PLP on serum indices of liver function.

Notes: Rats were treated with 60 mg/kg ANIT with different doses of PLP. The following seven liver function markers in the serum were assayed: (A) ALT; (B) AST; (C) TBIL; (D) DBIL; (E) ALP; (F) TBA; (G) γ-GT; and (H) PCA. Data are expressed as mean ± SD. ^##P<0.01 compared with control group; **P<0.01 compared with ANIT group.
Abbreviations: PLP, Paeonia lactiflora Pall.; ANIT, alpha-naphthylisothiocyanate; UDCA, ursodeoxycholic acid; ALT, alanine aminotransferase; AST, aspartate aminotransferase; TBIL, total bilirubin; DBIL, direct bilirubin; TBA, total bile acid; ALP, alkaline phosphatase; γ-GT, γ-glutamyl transpeptidase; PCA, principal component analysis; SD, standard deviation.

Figure 4 Effect of PLP on histological changes in the liver tissue of ANIT-induced rats.

Notes: Rats were treated with different doses of PLP. It represented different effects with histological changes. Damage to hepatocytes is pointed by black arrows. (A) Control; (B) ANIT; (C) UDCA; (D) PLP 20 g/kg; (E) PLP 40 g/kg; and (F) PLP 80 g/kg. (HE stained, 200× magnification).
Abbreviations: PLP, Paeonia lactiflora Pall.; ANIT, alpha-naphthylisothiocyanate; UDCA, ursodeoxycholic acid; HE, hematoxylin-eosin.

Figure 5 GSH level and Western blot analysis of pAkt, GCLc, GCLm, and Nrf2.

Notes: Rats were treated with different doses of PLP. (A) The Western blot images of pAkt, GCLc, GCLm, and Nrf2; (B) GSH levels in liver tissue. Data are expressed as mean ± SD. ^##P<0.01 compared with control group; **P<0.01 compared with ANIT group.
Abbreviations: PLP, Paeonia lactiflora Pall.; ANIT, alpha-naphthylisothiocyanate; UDCA, ursodeoxycholic acid; Nrf2, NF-E2-related factor 2; GSH, glutathione; GCLc, glutamate-cysteine ligase catalytic subunit; GCLm, glutamate-cysteine ligase modulatory subunit; SD, standard deviation.

Figure 6 mRNA expessions of GLCc, GLCm, Nqo1, HO-1, Akt, and Nrf2 (%).

Notes: Rats were treated with different doses of PLP. (A) GCLm; (B) GCLc; (C)Nqo1; (D) HO-1; (E) Akt; (F) Nrf2. Data are expressed as the mean ± SD. ^##P<0.01 compared with control group; **P<0.01 compared with ANIT group.
Abbreviations: PLP, Paeonia lactiflora Pall.; ANIT, alpha-naphthylisothiocyanate; UDCA, ursodeoxycholic acid; Nrf2, NF-E2-related factor 2; GCLc, glutamate-cysteine ligase catalytic subunit; GCLm, glutamate-cysteine ligase modulatory subunit; HO-1, heme oxygenase-1; NQO1, NAD(P)H/quinone oxidoreductase 1; SD, standard deviation.

Figure 7 PLP putative targets network validation and its possible mechanism.

Notes: (A) The relationship between 33 putative targets and five ingredients of PLP in silico validation. (B) Top 20 gene functions of the putative targets. (C) The possible mechanism of PLP on cholestasis via Nrf2/PI3K/Akt pathway. (D) Top 20 pathways of the putative targets.
Abbreviations: PLP, Paeonia lactiflora Pall.; ANIT, alpha-naphthylisothiocyanate; Nrf2, NF-E2-related factor 2; GSH, Glutathione; GCLc, glutamate-cysteine ligase catalytic subunit; GCLm, glutamate-cysteine ligase modulatory subunit.

Figure S1 Mass-to-charge (m/z) information of four compounds.

Notes: The black bars represent the positive mode and the red bars represent the negative mode. (A) Oxypaeoniflorin; (B) albiflorin; (C) paeoniflorin; (D) benzoylpaeoniflorin.

Table S1 PLP putative targets

Compounds	Targets (protein ID)
Paeoniflorin	Q9Y6L6, Q9NPD5, P03372, P05231, P01375, P18428, P08571
Paeonol	P00352, P08684, P15428, P28482, Q9Y6L6, Q9NPD5, P60568, P01375, P21397, P27338, O95433, Q04206, P25963, P10415, Q07812, P05362, P14679, P31749, P60484
Albiflorin	P03372
Beta-sitosterol	P08684, P10635, P06746, P00734, P49841, P18031, P07339, P80365, P08183, Q9Y6L6, Q9NPD5, O95342, P08047, P03372
Daucosterol	P06746, P00734, P49841, P18031, P08047

Notes: Adapted from Chen CY. TCM Database@Taiwan: the world’s largest traditional Chinese medicine database for drug screening in silico. PLoS One. 2011;6(1): e15939.¹ Adapted from Hao Ye, Li Ye, Hong Kang, et al. HIT: linking herbal active ingredients to targets. Nucleic Acids Res. 2011;39:D1055–D1059.² Adapted from Kruger FA, Rostom R, Overington JP. Mapping small molecule binding data to structural domains. BMC Bioinformatics. 2012;13:S11.³ The targets were saved as Uniprot ID.

Abbreviation: PLP, Paeonia lactiflora Pall.

ChenCYTCM Database@Taiwan: the world’s largest traditional Chinese medicine database for drug screening in silicoPLoS One201161e1593921253603

 PubMed Web of Science ®Google Scholar

HaoYeLiYeKangHongHIT: linking herbal active ingredients to targetsNucleic Acids Res201139D1055D105921097881

 PubMed Web of Science ®Google Scholar

KrugerFARostomROveringtonJPMapping small molecule binding data to structural domainsBMC Bioinformatics201213S1123282026

 PubMed Web of Science ®Google Scholar