Protective effects of alginate–chitosan microspheres loaded with alkaloids from Coptis chinensis Franch. and Evodia rutaecarpa (Juss.) Benth. (Zuojin Pill) against ethanol-induced acute gastric mucosal injury in rats

Figures & data

Table 1 Real-time RT-PCR oligonucleotide primers

Gene	Primer	Sequence (5′–3′)	PCR product (bp)
GAPDH (NM_017008.4)	Forward	AGACAGCCGCATCTTCTTGT	142
	Reverse	TGATGGCAACAATGTCCACT
iNOS (NM_012611.3)	Forward	CACCTTGGAGTTCACCCAGT	170
	Reverse	ACCACTCGTACTTGGGATGC
TNF-α (NM_012675.3)	Forward	TGACCCCCATTACTCTGACC	142
	Reverse	CGTGTGTTTCTGAGCATCGT
IL-1β (NM_031512.2)	Forward	AAAAATGCCTCGTGCTGTCT	127
	Reverse	GGGATTTTGTCGTTGCTTGT

Abbreviations: TNF-α, tumor necrosis factor-α; IL-1β, interleukin 1β; iNOS, inducible nitric oxide synthase; RT-PCR, reverse transcription polymerase chain reaction.

Figure 1 Optical micrographs and SEM micrographs of alginate–chitosan microspheres: (A) freeze-dried microsphere; (B) microsphere loaded with alkaloids; (C) particle size distribution of alkaloid-loaded microspheres.

Abbreviation: SEM, scanning electron microscope.

Figure 2 DSC thermograms of (a) sodium alginate, (b) chitosan, (c) physical mixture of chitosan and sodium alginate, and (d) alkaloid-loaded microspheres.

Abbreviation: DSC, differential scanning calorimetry.

Figure 3 FTIR spectra of (a) sodium alginate, (b) chitosan, (c) physical mixture of chitosan and sodium alginate, and (d) alkaloid-loaded microspheres.

Abbreviation: FTIR, fourier transform infrared spectroscopy.

Table 2 The contents of seven alkaloids in microspheres (n=3)

Number	Seven alkaloids	Content, mean ± SD (mg/kg)	Total alkaloid (mg/kg)
1	Epiberberine	64.7±5.3
2	Jatrorrhizine	37.6±5.1
3	Coptisine	67.2±9.1
4	Palmatine	45.9±5.8	1,210.0
5	Berberine	256.1±31.8
6	Evodiamine	33.3±10.4
7	Rutaecarpine	705.3±156.4

Abbreviation: SD, standard deviation.

Figure 4 Release curves of seven alkaloids from alginate–chitosan microspheres loaded with total alkaloids extracted from Coptis chinensis and Evodia rutaecarpa.

Figure 5 Mucoadhesive properties (A) in vitro and (B) in vivo.

Notes: (A) Microspheres sticking to stomach mucosa (a) after rinsing and (b) before rinsing. (B) Characterizations of mucoadhesive properties of FITC-labeled chitosan-coated alkaloid-loaded microspheres in vivo (Left→Right: stomach, duodenum, and jejunum) varied from 0 to 12 hours.
Abbreviation: FITC, fluorescein isothiocyanate.

Table 3 Macroscopic analysis results of mucosa lesions induced by ethanol

Groups	Pretreatment	Mucosal lesion index (score)	Percentage of inhibition (%)	Mean mucus weight (mg)
1	Normal control	0	–	186.8±1.62
2	Model group	115.99±8.74*	–	140.1±4.11*
3	Omeprazole (20 mg/kg)	24.52±1.90**	78.9	147.7±10.0
4	Microspheres (0.02 mg/kg)	46.47±11.14**	59.9	135.3±8.87
5	Microspheres (0.05 mg/kg)	30.71±2.35**	73.5	152.0±2.77
6	Microspheres (0.18 mg/kg)	38.73±6.07**	66.6	171.6±6.10**

Notes: Data are expressed as mean ± standard error mean.

* P<0.05 compared to the control group;

** P<0.05 compared to the model group.

Figure 6 Effects of alkaloid-loaded microspheres on (A) gross appearance and (B) H&E-stained micrographs of stomach.

Notes: (A) (a) Normal control group, (b) model group, (c) omeprazole group (20 mg/kg), microsphere groups (d) at 0.02 mg/kg, (e) at 0.05 mg/kg, and (f) at 0.18 mg/kg. (B) H&E-stained micrographs of stomach from (a) normal control (40×), (b) model group (b-40×, b1-100×), (c) omeprazole at 20 mg/kg (40×), microsphere groups (d) at 0.02 mg/kg (d-40×, d1-100×), (e) at 0.05 mg/kg (40×), (f) at 0.18 mg/kg (40×).
Abbreviation: H&E, hematoxylin and eosin.

Figure 7 Effects of alkaloid-loaded microspheres on production of PGE₂, TNF-α, and IL-1β in ethanol-induced gastric mucosa lesions.

Notes: (A) PGE₂, (B) TNF-α, and (C) IL-1β in gastric mucosal homogenates were measured by ELISA. Data were expressed with mean ± SE from three independent experiments. *P<0.05 (n=4) compared to the normal control group, **P<0.05 (n=4) compared to the model group.
Abbreviations: PEG₂, Prostaglandin E₂; OME, omeprazole; TNF-α, tumor necrosis factor-α; IL-1β, interleukin 1β; ELISA, enzyme-linked immunosorbent assay; SE, standard error.

Figure 8 Effects of alkaloid-loaded microspheres on mRNA expression of iNOS, TNF-α, and IL-1β in ethanol-induced gastric mucosa lesions.

Notes: The mRNA expressions of (A) iNOS, (B) TNF-α, and (C) IL-1β were measured by real-time RT-PCR. Data were expressed with mean ± SE from three independent experiments. *P<0.05 (n=4) compared to the normal control group; **P<0.05 (n=4) compared to the model group.
Abbreviations: OME, omeprazole; TNF-α, tumor necrosis factor-α; IL-1β, interleukin 1β; ELISA, enzyme-linked immunosorbent assay; SE, standard error; iNOS, inducible nitric oxide synthase; RT-PCR, reverse transcription polymerase chain reaction.