Association Between Intestinal Prevotella copri Abundance and Glycemic Fluctuation in Patients with Brittle Diabetes

Figures & data

Table 1 The Primers Used for qPCR Analysis of 16S rDNA

Gene	Primer Sequence (5’-3’)
Prevotella copri	F: CATTAGATACCCTGGTAGTCC
	R: CATGCAGCACCTrCACAA
GAPDH	F: GGAGCGAGATCCCTCCAAAAT
	R: GGCTGTTGTCATACTTCTCATGG

Abbreviations: qPCR, Quantitative polymerase chain reaction; rDNA, Ribosomal RNA; GAPDH, Glyceraldehyde-3-phosphate dehydrogenase.

Table 2 Demographic Characteristics

Variables	BDM Group (n = 10)	GT2DM Group (n = 10)	P
Male/female	9/1	7/3	0.582
Age (year)	42.50 ± 19.58	52.10 ± 10.55	0.194
BMI (kg/m2)	20.59 ± 1.79	22.16 ± 1.78	0.064
Duration of diabetes (months)	66.00 ± 50.60	30.80 ± 50.12	0.243
T1DM/T2DM	8/2	0/10
HbA1c (%)	11.68 ± 2.37	10.34 ± 3.57	0.335
TCH (mmol/L)	4.41 ± 0.66	4.87 ± 0.70	0.149
TG (mmol/L)	0.94 ± 0.45	1.23 ± 0.41	0.15
LDL-C (mmol/L)	2.42 ± 0.55	2.80 ± 0.50	0.117
HDL-C (mmol/L)	1.31 ± 0.41	1.28 ± 0.27	0.835
AUCC-P	0.99 ± 1.17	6.96 ± 3.91	0.001
SDBG (mmol/L)	5.02 ± 0.51	2.31 ± 0.53	<0.001

Abbreviations: BMI, Body mass Index; HbA1c, Hemoglobin A1c; TCH, Total cholesterol; TG, Triglyceride; LDL-C, Low-density lipoprotein cholesterol; HDL-C, High-density liptein cholesterol; AUC_C-P, Area under the C-peptide curve; SDBG, Standard deviation of blood glucose.

Figure 1 Gut microbiota analysis. (A) Principal coordinates analysis (PCoA) of the BDM group (n = 10) and NBT2DM group (n = 10) subjects based on unweighted UniFrac distance measures (Yellow triangles: BDM group; blue circles: NBT2DM group); (B) Shannon index of alpha diversity in the BDM group and NBT2DM group; (C) Taxonomic summary of the fecal microbiota at the phylum level and (D) at the genus level; (E) Discriminative taxa at the species level as determined by linear discriminant analysis (LDA) effect size.

Figure 2 Correlation between glycemic fluctuation and bacterial relative abundance. (A) Prevotella copri, r = −0.477, P = 0.034; (B) Bifidobacterium, r = −0.389, P = 0.090; (C) AKKermansia, r = 0.176, P = 0.458; (D) Collinsella, r = 0.360, P = 0.119; (E) Streptococcus, r = 0.411, P = 0.072; (F) Lactobacillus, r = 0.067, P = 0.780.

Table 3 Clinicopathological Parameters of the Subjects in the Validation Cohort

Variables	BDM Group	GT2DM Group	P
Number	41	36
Male/female	26/15	19/17	0.365
Age (year)	44.24 ± 14.51	50.81 ± 14.87	0.054
BMI (kg/m^2)	21.26 ± 2.05	21.97 ± 1.43	0.081
Duration of diabetes (month)	118.05 ± 99.52	87.78 ± 75.97	0.142
T1DM/T2DM	35/6	0/36
HbA1c (%)	9.12 ± 2.67	9.99 ± 2.58	0.150
TCH (mmol/L)	4.12 ± 0.96	4.50 ± 1.01	0.088
TG (mmol/L)	1.33 ± 0.90	1.68 ± 0.94	0.103
LDL-C (mmol/L)	2.46 ± 0.93	2.81 ± 0.82	0.083
HDL-C (mmol/L)	1.18 ± 0.33	1.06 ± 0.27	0.074
AUCC-P	0.05 (0.02, 0.51)	5.64 (3.34,8.16)	<0.001
SDBG	3.48 ± 0.70	2.70 ± 0.53	<0.001

Abbreviations: BMI, Body mass index; HbA1c, Hemoglobin A1c; TCH, Total cholesterol; TG, Triglyceride; LDL-C, Low-density lipoprotein cholesterol; HDL-C, High-density liptein cholesterol; AUC_C-P, Area under the C-peptide curve; SDBG, standard deviation of blood glucose.

Figure 3 (A) Comparison of the content of Prevotella copri in the intestinal flora of the validation cohort. The abundance of Prevotella copri in the intestinal flora of patients with BDM was significantly lower than that of patients with NBT2DM, P = 0.002 (**P≤0.01); (B) Validation cohort analysis of the correlation between the intestinal Prevotella copri abundance and glycemic fluctuation in patients with BDM, r = −0.318, P = 0.043.