Effects of Glycemic Variability on Regulatory T Cells in Patients with Type 2 Diabetes and Kidney Disease

Figures & data

Table 1 Primer Sequences for RT-PCR in Human

Gene (Human)	Forward (5’-3’)	Reverse (5’-3’)
β-Actin	TCAAGATCATTGCTCCTCCTGAG	ACATCTGCTGGAAGGTGGACA
GAPDH	ACCACAGTCCATGCCATCAC	TCCACCACCCTGTTGCTGTA
TGF-β	AACGAACTGGCTGTCTGC	CCTCTGCTCATTCCGCTTAG
IL-17	ACTACAACCGATCCACCTCAC	ACTTTGCCTCCCAGATCACAG
IL-6	GTATGAACA- GCGATGATGCAC	GAAACGGAACTCCAGAAGACC
IL-10	GCTGGAGGACTTTAAGGGTTAC	ATGTCTGGGTCTTGGTTC
IFN-γ	GCAGAGCCAAATTGTCTCCT	ATGCTCTTCGACCTCGAAAC
FOXP3	GCACCTTCCCAAATCCCA	GGCCACTTGCAGACACCA

Table 2 Baseline Patient Characteristics

Clinical Parameters	Normoalbuminuria	Microalbuminuria	Macroalbuminuria	P
	n=47	n=47	n=49	ANOVA Test
Gender (male/female)	28/19	25/22	27/22
Age (years)	54.12±9.65	53.56±10.65	56.32±9.15	0.862
Duration of DM (years)	7.00 (3.00, 12.00)	10.00 (5.00, 15.00)^a	12.00 (9.25, 15.00)^a,b	<0.001
BMI (kg/m²)	23.56±2.53	24.21±4.92	25.37±3.72	0.278
Systolic BP (mm Hg)	130.96±15.21	131.02±20.42	145.21±22.09^a,b	<0.001
Diastolic BP (mm Hg)	86.56±10.10	85.47±12.05	87.43±12.31	0.257
HbA1c (%)	7.98±1.87	8.79±1.65	9.34±1.65^a	0.009
FBG (mmol/L)	8.58 (5.79, 10.05)	9.02 (6.57, 12.73)	9.91 (8.17, 12.38)^a	0.092
TC (mmol/L)	4.51±1.15	4.21±1.12	5.36±1.91^a,b	0.016
TG (mmol/L)	2.60±0.78	2.57±0.86	2.85±1.26	0.482
HDL-C (mmol/L)	1.13±0.42	1.00±0.27	1.07±0.46	0.342
LDL-C (mmol/L)	2.85±0.85	2.77±0.91	3.24±1.31	0.060
sUA (μmol/L)	287.91±73.64	332.60±118.2	375.12±126.09^a	0.013
Serum Cr (μmol/L)	67.23±18.34	69.01±21.12	150.01±25.06^a,b	<0.001
UACR (mg/g)	13.70±7.29	98.39±60.50^a	1017.46±571.48^a,b	<0.001
eGFR (mL/min per 1.73m^2)	112.49±12.22	110.68±19.15	46.70±11.18^a,b	<0.001

Notes: Values were expressed as means ± SD and median with range according to the nature of data. ^avs normoalbuminuria groups, P< 0.05; ^bvs microalbuminuria groups, P< 0.05.

Abbreviations: DM, diabetes mellitus; BMI, body mass index; BP, blood pressure; HbA1c, hemoglobin A1c; FPG, fasting plasma glucose; TC, total cholesterol; TG, total triglyceride; HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; sUA, serum uric acid; Cr, creatinine; UACR, urinary albumin-to-creatinine ratio; eGFR, estimated glomerular filtration rate.

Figure 1 Representative FACS dot-plots used for the quantification of Tregs, FACS for the quantification of the suppressive function of Tregs, and qPCR for the quantification of FOXP3, IL-10, and TGF-β mRNA expressions. PBMCs were stained with anti-CD4-FITC, anti-CD25-PE, and anti-FOXP3-APC antibodies. (A) Tregs were defined as CD4+CD25+ FOXP3+ cells in the three groups; the average fractions of Tregs are shown in the right panels (n = 15 in each group). FOXP3 (B), TGF-β (C), and IL-10 (D) mRNA expressions in Tregs of the three groups (n = 8 in each group). (E) Representative suppressive functions of Tregs in the three groups are presented (n = 6 in each group). The CD4+CD25+ cells (Tregs) and CD4+CD25- cells were isolated and cocultured at a ratio of 8:1 for 72h. The proliferation of Teff was detected by FACS. *p< 0.05; **p < 0.01.

Figure 2 Representative FACS dot-plots were used for the quantification of T cell subpopulations and qPCR for the quantification of inflammatory factor mRNA expressions. PBMCs were stained with anti-CD4-PerCP-Cy5-5, anti-IFN-γ-FITC, IL-17A-PE, and anti-IL-4-PE antibodies (n = 15 in each group). (A) Th17 cells were defined as CD4+IL-17A+ cells in the three groups; the average fractions of Th17 cells are shown in the right panels. (B) Th1 cells were defined as CD4+IFN-γ+ cells in the three groups, the average fractions of Th1 cells are shown in the right panels. (C) Th2 cells were defined as CD4+IL4+ cells in the three groups, the average fractions of Th2 cells are shown in the right panels. The IL-6 (D), IL-17 (E), and IFN-γ (F) mRNA expressions in PBMCs of the three groups are shown (n = 8 in each group). *p< 0.05; **p < 0.01.

Table 3 Glycemic Parameters Obtained from CGM

Variable	Normoalbuminuria	Microalbuminuria	Macroalbuminuria	P
	n=47	n=47	n=49	ANOVA Test
MBG (mmol/L)	8.87±1.70	9.68±1.61^a	10.67±2.23^a,b	<0.001
% CV	23.00 (18.84, 28.00)	22.97 (19.76, 28.39)	23.80 (17.96, 31.33)	0.807
MAGE (mmol/L)	4.91±1.88	5.73±2.27	6.35±2.99^a	0.039
% TIR (3.9–10mmol/L)	73.61 (57.64, 85.00)	57.64 (43.40, 72.22)^a	48.32 (21.70, 77.84)^a	<0.001
% TBR (<3.9mmol/L)	0.00 (0.00, 0.00)	0.00 (0.00, 0.00)	0.00 (0.00, 0.00)	0.995
% TAR (10.1–13.9mmol/L)	22.57 (8.33, 36.46)	33.33 (20.49, 45.49)^a	35.42 (22.40, 55.21)^a	<0.001
% TAR (>13.9mmol/L)	0.00 (0.00, 5.50)	5.81 (0.00, 13.54)^a	8.45 (0.00, 16.60)^a	0.001

Notes: Values were expressed as means ± SD and median with range according to the nature of data. ^avs normoalbuminuria groups, P< 0.05; ^bvs microalbuminuria groups, P< 0.05.

Abbreviations: MBG, mean blood glucose; CV, coefficient of variation; MAGE, mean amplitude of glycemic excursions; TIR, time in range; TBR, time below range; TAR, times above range.

Figure 3 Linear correlation between the frequency of T cell subpopulations and some indexes of short-term GV. The relationships between the MAGE and frequency of Tregs (A), Th17 (B), Th1 (C), and Th2 (D) are shown. The relationships between the TIR and frequency of Tregs (E), Th17 (F), Th1 (G), and Th2 (H) are presented.

Table 4 Multivariate Linear Regression Model of GV Parameters Related to the Proportion of T Cell Subpopulations

Independent variables	Dependent Variable
	Tregs			Th17			Th1			Th2
	β	95% CI	p	β	95% CI	p	β	95% CI	p	β	95% CI	p
MAGE	−0.204	−0.281~ −0.014	0.031^a	0.188	−0.069~0.274	0.233	0.171	−0.153~0.731	0.292	0.187	−0.083~0.249	0.321

Note: ^aP< 0.05 was adjusted of gender, age, BMI, SBP, TC, LDL-C, sUA, the duration of DM, TIR, HbA1c, and UACR.

Abbreviation: MAGE, mean amplitude of glycemic excursions.