Genetic Polymorphism of Lipoprotein-Associated Phospholipase A2 Influences Susceptibility to Gestational Diabetes Mellitus in Chinese Population

Figures & data

Table 1 PCR Primers and Products for PLA2G7 Gene

PCR Primers	Sequences	PCR Products (bp)
rs1805017	F: 5′- ACCTTCTTGCGTTTATATTATCCATCC −3′	119
	R: 5′- CCCATAAGCCAGTGTGTTCC −3′
rs1805018	F: 5′-AGGGAAGGAGCATGCATAAA-3′	144
	R: 5′- CCTCCTCTTGTTTCAGGGTTC-3′
rs76863441	F: 5′-TCTTCTAACACCACGAAATAGC-3′	589
	R: 5′- GTCTTGTCCCAACTCTTACCC-3′

Figure 1 PCR products were sequenced for rs1805017 loci of PLA2G7 gene polymorphism (reverse sequencing). (A) rs1805017-A/A; (B) rs1805017-A/G; (C) rs1805017-G/G.

Figure 2 PCR products were sequenced for rs1805018 loci of PLA2G7 gene polymorphism. (A) rs1805018-T/T; (B) rs1805017-C/T; (C) rs1805017-C/C.

Figure 3 PCR products were sequenced for rs76863441 loci of PLA2G7 gene polymorphism (reverse sequencing). (A) rs76863441-G/G; (B) rs76863441-G/T; (C) rs76863441-T/T.

Table 2 The Participates Characteristics of Both GDM Group and Control Group (Mean ± SD)

Basic Information	Control (N=89)	GDM Group (N=82)	P
Age(years)	30.17±3.80	31.41±4.50	0.053
TG (mmol/L)	2.10±0.64	2.25±0.80	0.156
TC (mmol/L)	6.04±1.00	5.75±1.10	0.073
LDL-C (mmol/L)	3.39±0.78	3.24±0.86	0.225
HDL-C (mmol/L)	2.00±0.33	1.90±0.34	0.053

Abbreviations: GDM, gestational diabetes mellitus; TG, triglyceride; TC, total cholesterol; LDL-C, low-density lipoprotein cholesterol; HDL-C, high-density lipoprotein cholesterol.

Table 3 Comparison of PLA2G7 Genotype and Allele Frequency Between GDM Group and Control Group

PLA2G7 Polymorphism	Control Group (N=89)		GDM Group (N=82)		OR (95% CI)^a	P^a
	n	Percentage (%)	n	Percentage (%)
rs1805017
GG	48	54.0	51	62.2	1.00^REF
GA	40	44.9	29	35.4	1.47(0.79–2.72)	0.226
AA	1	1.1	2	2.4	0.53(0.05–6.05)	0.605
G	136	76.4	131	79.9	1.00^REF
A	42	23.6	33	20.1	1.23(0.73–2.05)	0.438
rs1805018
TT	74	83.1	70	85.4	1.00^REF
TC	14	15.7	11	13.4	1.20(0.51–2.83)	0.670
CC	1	1.2	1	1.2	0.95(0.06–15.42)	0.969
T	162	91.0	151	92.1	1.00^REF
C	16	9.0	13	7.9	1.15(0.53–2.47)	0.725
rs76863441
GG	86	96.6	73	89.0	1.00^REF
GT	2	2.2	8	9.8	0.21(0.04–1.03)	0.049
TT	1	1.1	1	1.2	0.85(0.05–13.81)	0.908
G	174	97.8	154	93.9	1.00^REF
T	4	2.2	10	6.1	0.35(0.11–1.15)	0.073

Note: ^aAdjusted for sex and age by logistic regression model.

Abbreviations: GDM, gestational diabetes mellitus; OR, odds ratio; CI, confidential index.

Figure 4 Lp-PLA2 concentration was significantly higher in GDM group than control group. ***P<0.05.

Data Sharing Statement

All data generated or analyzed during this study are included in this published article.