Integrated Analysis of Ferroptosis and Immunity-Related Genes Associated with Diabetic Kidney Disease

Figures & data

Table 1 Primer Sequences of RT-PCR

Primer	Forward Primer	Reverse Primer
Ccl5	CCTGCTGCTTTGCCTACCTCTC	ACACACTTGGCGGTTCCTTCGA
Il18	GACAGCCTGTGTTCGAGGATATG	TGTTCTTACAGGAGAGGGTAGAC
Cybb	TGGCGATCTCAGCAAAAGGTGG	GTACTGTCCCACCTCCATCTTG
Fcgr2b	CTACTGTGGACAGCCGTGCTAA	TCACCGTGTCTTCCTTGAGCAC
Myd88	ACCTGTGTCTGGTCCATTGCCA	GCTGAGTGCAAACTTGGTCTGG
Ccr2	GCTGTGTTTGCCTCTCTACCAG	CAAGTAGAGGCAGGATCAGGCT
β-actin	CATTGCTGACAGGATGCAGAAGG	GCTGGAAGGTGGACAGTGAGG

Figure 1 Flow chart of the study design.

Abbreviations: FIRDEGs, ferroptosis immune-related differentially expressed genes; GSEA, Gene Set Enrichment Analysis; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPI network, Protein-protein interaction network; TF, Transcription factors; Co-DEGs, Common differentially expressed genes; ROC, Receiver operating characteristic curve.

Figure 2 Differential gene analysis of diabetic kidney diseases databases. (A) The volcano map of GSE30122. (B) The volcano map of GSE30528. (C) The volcano map of GSE30529. (D) The heatmap of GSE30122. (E) The heatmap of GSE30528. (F) The heatmap of GSE30529. (G) Venn diagram of the Co-DEGs in GSE30122, GSE30528 and GSE30529. (H) Venn diagram of Co-DEGs and FIRGs.

Abbreviations: Co-DEGs, Common differentially expressed genes; FIRGs, ferroptosis immune-related genes; DKD, Diabetic kidney disease.

Table 2 GO Enrichment Analysis Results of Ferroptosis Immune Related DEGs

ONTOLOGY	ID	Description	Gene Ratio	BgRatio	P value	P adjust	Q value
BP	GO: 0042110	T cell activation	19/79	464/18670	5.05E-14	1.26E-10	7.99E-11
BP	GO: 0050900	Leukocyte migration	19/79	499/18670	1.85E-13	2.31E-10	1.46E-10
BP	GO: 0002697	Regulation of immune effector process	18/79	458/18670	5.16E-13	4.29E-10	2.72E-10
BP	GO: 0007159	Leukocyte cell-cell adhesion	16/79	337/18670	6.86E-13	4.29E-10	2.72E-10
BP	GO: 0002696	Positive regulation of leukocyte activation	16/79	380/18670	4.25E-12	2.13E-09	1.35E-09
CC	GO: 0005604	Basement membrane	6/79	95/19717	2.23E-06	2.85E-04	2.26E-04
CC	GO: 0042581	Specific granule	7/79	160/19717	3.61E-06	2.85E-04	2.26E-04
CC	GO: 0009897	External side of plasma membrane	10/79	393/19717	3.74E-06	2.85E-04	2.26E-04
CC	GO: 0062023	Collagen-containing extracellular matrix	10/79	406/19717	4.99E-06	2.85E-04	2.26E-04
CC	GO: 0008305	Integrin complex	4/79	31/19717	6.92E-06	3.17E-04	2.50E-04
MF	GO: 0005126	Cytokine receptor binding	11/80	286/17697	6.32E-08	1.92E-05	1.50E-05
MF	GO: 0050839	Cell adhesion molecule binding	13/80	499/17697	3.43E-07	5.21E-05	4.06E-05
MF	GO: 0005178	Integrin binding	7/80	132/17697	2.21E-06	2.24E-04	1.75E-04
MF	GO: 0005201	Extracellular matrix structural constituent	7/80	163/17697	8.93E-06	5.20E-04	4.05E-04
MF	GO: 0005539	Glycosaminoglycan binding	8/80	229/17697	9.05E-06	5.20E-04	4.05E-04

Abbreviations: FIRDEGs, ferroptosis immune related differentially expressed genes; GO, Gene Ontology; BP, biological process; CC, cellular component; MF, molecular function.

Table 3 KEGG Enrichment Analysis Results of Ferroptosis Immune Related DEGs

ID	Description	Gene Ratio	BgRatio	P value	P adjust	Q value
hsa 04512	ECM-receptor interaction	7/47	88/8164	5.8881E-07	5.5079E-05	3.9738E-05
hsa 04510	Focal adhesion	8/47	201/8164	1.619E-05	0.00057637	0.00041583
hsa 05417	Lipid and atherosclerosis	8/47	215/8164	2.6367E-05	0.00078222	0.00056435
hsa 04062	Chemokine signaling pathway	7/47	192/8164	0.00010112	0.00199984	0.00144281
hsa 04151	PI3K-Akt signaling pathway	9/47	354/8164	0.0001545	0.00271339	0.00195762
hsa 04670	Leukocyte transendothelial migration	5/47	114/8164	0.0004672	0.00489181	0.00352928
hsa 04664	Fc epsilon RI signaling pathway	4/47	68/8164	0.00059969	0.00535516	0.00386357
hsa 04621	NOD-like receptor signaling pathway	6/47	184/8164	0.0006017	0.00535516	0.00386357
hsa 04810	Regulation of actin cytoskeleton	6/47	218/8164	0.00145551	0.01177641	0.00849629
hsa 04145	Phagosome	5/47	152/8164	0.00171101	0.0132417	0.00955344
hsa 04514	Cell adhesion molecules	5/47	157/8164	0.00197318	0.01463442	0.01055824
hsa 04640	Hematopoietic cell lineage	4/47	99/8164	0.00243385	0.01732901	0.0125023
hsa 04064	NF-kappa B signaling pathway	4/47	104/8164	0.00291128	0.01786926	0.01289207
hsa 04620	Toll-like receptor signaling pathway	4/47	104/8164	0.00291128	0.01786926	0.01289207
hsa 04613	Neutrophil extracellular trap formation	5/47	190/8164	0.00449826	0.02668969	0.01925572
hsa 04623	Cytosolic DNA-sensing pathway	3/47	63/8164	0.00557711	0.0310227	0.02238184
hsa 04060	Cytokine-cytokine receptor interaction	6/47	295/8164	0.00652619	0.03369882	0.02431257
hsa 04650	Natural killer cell mediated cytotoxicity	4/47	131/8164	0.00662617	0.03369882	0.02431257
hsa 04015	Rap1 signaling pathway	5/47	210/8164	0.00684686	0.03385392	0.02442447
hsa 04662	B cell receptor signaling pathway	3/47	82/8164	0.01152737	0.05129682	0.03700894
hsa 04217	Necroptosis	4/47	159/8164	0.01290078	0.05600828	0.0404081
hsa 04657	IL17 signaling pathway	3/47	94/8164	0.0166326	0.06728642	0.0485449
hsa 04512	ECM-receptor interaction	7/47	88/8164	5.8881E-07	5.5079E-05	3.9738E-05

Abbreviations: KEGG, Kyoto Encyclopedia of Genes and Genomes; FIRDEGs, ferroptosis immune related differentially expressed genes.

Figure 3 Go and KEGG Functional enrichment analysis. The bubble chart of (A) GO and (B) KEGG enrichment analyses of FIRDEGs. The circular trellis of (C) GO and (D) KEGG enrichment analyses of FIRDEGs. The bar graph of (E) GO and (F) KEGG enrichment analyses of FIRDEGs. The screening criteria for GO and KEGG enrichment items were P < 0.05 and FDR < 0.05.

Abbreviations: FIRDEGs, ferroptosis immune-related differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto encyclopedia of genes and genomes.

Figure 4 Gene set enrichment analysis. (A) GSEA plot showing most enriched gene sets in the DKD group and normal controls. The differential expression genes in GSE30122 were significantly enriched in (B) PI3K pathway, (C) IL10 pathway, (D) Notch pathway and (E) IL17 pathway. The screening criteria for GSEA items were P < 0.05 and FDR < 0.25.

Abbreviations: DKD, Diabetic kidney disease; GSEA, Gene set enrichment analysis; NES, normalized enrichment score.

Figure 5 Protein–Protein Interaction Network. (A) PPI network of FIRDEGs. (B) Venn maps of common genes of the top 15 FIRDEGs were selected using five algorithms: MCC, MNC, EPC, Degree and DMNC. (C) PPI network of the six hub genes.

Abbreviations: FIRDEGs, ferroptosis immune-related differentially expressed genes; PPI, protein-protein interaction; Degree, Degree correlation; MNC, Maximum neighborhood component; MCC, Maximal clique centrality; EPC, Edge percolated component; DMNC, Density of maximum neighborhood component.

Figure 6 Multi-factor regulatory analysis. (A) The mRNA-miRNA interaction network of hub genes. (B) The mRNA-TF interaction network of the hub genes. (C) The mRNA–drug interaction network of hub genes.

Abbreviation: TF, Transcription factor.

Figure 7 Expression differences and correlation analysis of hub genes. Group comparison of the expression of hub genes in datasets (A) GSE30122, (C) GSE30528, and (E) GSE30529. Correlation heatmap of hub gene expression in datasets (B) GSE30122, (D) GSE30528, and (F) GSE30529. Vs Normal group, *P < 0.05, **P < 0.01 and ***P < 0.001.

Figure 8 Clinical relevance of the expression of ferroptosis immune-related DEGs. Correlation analysis between GFR and (A) Ccl5, (B) Ccr2, (C) Cybb, (D) Fcgr2b, (E) Il18, (F) Myd88; Correlation analysis between serum creatinine and (G) Ccl5, (H) Ccr2, (I) Cybb, (J) Fcgr2b, (K) Il18, (L) Myd88.

Figure 9 ROC curve analysis. ROC curves for (A) Ccl5, (B) Il18, (C) Cybb, (D) Fcgr2b, (E) Myd88, and (F) Ccr2 in the GSE30122 dataset. ROC curve of (G) Ccl5, (H) Il18, (I) Cybb, (J) Fcgr2b, (K) Myd88, and (L) Ccr2 in the GSE30528 dataset. ROC curves of (M) Ccl5, (N) Il18, (O) Cybb, (P) Fcgr2b, (Q) Myd88, and (R) Ccr2 in the GSE30529 dataset.

Abbreviations: ROC, Receiver operating characteristic curve; AUC, area under the curve.

Figure 10 Immune cell-infiltration analysis of GSE30122 dataset. (A) Bar chart of immune cell infiltration in the dataset. (B) Comparison of immune cell infiltration between normal and NC groups. (C) Correlation heatmap of FIRDEGs and immune cells in GSE30122 dataset. Vs Normal group; *P < 0.05; **P < 0.01 and ***P < 0.001.

Abbreviation: ns, no significant.

Figure 11 Basic information of mouse model. (A) Kidney weight/body weight ratio. (B) Blood glucose level. (C) 24 h urine albumin excretion levels. (D) Serum creatinine level. (E) Serum urea nitrogen. (F) H&E staining of the mouse kidneys. (G) PAS staining of mouse kidneys. The results are expressed as the mean ± SD. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs db/m. All figures scale bar = 50 μm.

Figure 12 Validation of ferroptosis immune-related DEGs in mouse model. (A) IHC assay of Gpx4 protein expression in the mouse kidneys. (B) IHC assay of Acsl4 protein expression in the mouse kidneys. The AOD of (C) Gpx4 and (D) Acsl4 between two groups. (E–J) Relative expression of mRNA by RT-PCR (n = 6). The results are expressed as the mean ± SD. **P < 0.01, ***P < 0.001, ****P < 0.0001 vs db/m. All figures scale bar = 50 μm.