Interaction between leucine and phosphodiesterase 5 inhibition in modulating insulin sensitivity and lipid metabolism

Figures & data

Table 1 RT-PCR probes ID and sequences

	ABI assay ID
FAS	Mm01204974_m1
SCD1	Mm00772290_m1
COX1	Mm04225243_g1
ACOX1	Mm01246834_m1
CPT1A	Mm01231183_m1
CPT1B	Mm00487191_g1
IL-6	Mm00446190_m1
IL-1β	Mm01336189_m1
TNFα	Mm00443258_m1
MCP1 (ccl2)	Mm00441242_m1
	Forward	Reverse	Probe
18s	AGTCCCTGCCCTTTGTACACA	GATCCGAGGGCCTCACTAAAC	CGCCCGTCGCTACTACCGATTGG
ACC	GGGCTCCCTGGATGACAAC	TTCCGGGAGGAGTTCTGGA	CTCTGATGAGGACCCTAGTGCCGGC
PPARα	GACAAGGCCTCAGGGTACCA	GCCGAATAGTTCGCCGAAA	AGCCCTTACAGCCTTCACATGCGTGA

Abbreviations: ABI, Applied Biosystems Inc (Foster City, CA, USA); RT-PCR, reverse transcription polymerase chain reaction; FAS, fatty acid synthase; SCD1, stearoyl-CoA desaturase-1; COX1, cyclooxygenase 1; ACOX1, acyl-CoA oxidase; CPT1A, carnitine palmitoyltransferase 1A; CPT1B, carnitine palmitoyltransferase 1B; IL-6, interleukin 6; IL-1β, interleukin-1 beta; TNFα, tumor necrosis factor alpha; MCP1, monocyte chemotactic protein 1; ACC, acetyl CoA carboxylase; PPARα, peroxisome proliferator-activated receptor alpha.

Figure 1 PDE5-inhibitors combined with Leu increases fatty acid oxidation in vitro.

Notes: Differentiated C2C12 muscle cells, 3T3-L1 adipocytes, or HepG2 cells were treated with indicated treatments for 24 hours. OCR after 200 μM palmitate injection (A and C) was measured and the AUC was calculated. (A) OCR over a 4-hour period in C2C12 muscle cells. (B–D) The calculated AUC of the OCR expressed as fold change compared to control (cells maintained in media without treatments). Data are represented as mean ± SD (n=5). * indicates significant difference to the control (P<0.05).
Abbreviations: PDE5, phosphodiesterase 5; Leu, leucine; OCR, oxygen consumption rate; AUC, area under the curve; Sild, sildenafil; Icar, icariin; SD, standard deviation.

Figure 2 PDE5-inhibitors combined with Leu increases NO production and mitochondrial biogenesis in vitro.

Notes: Differentiated C2C12 muscle cells were incubated with or without indicated treatments for (A) 4 hours and stained with DAF-2DA for measurement of NO production or for (B) 48 hours and stained with the mitochondrial probe NAO. Data are normalized to cellular protein and expressed as mean ± SEM (n=4–6).
Abbreviations: AFU, arbitrary fluorescence units; DAF-2DA, diaminofluorescein-2 diacetate; PDE5, phosphodiesterase 5; Leu, leucine; NAO, 10-N-nonyl-acridine orange; NO, nitric oxide; ns, not significant; Sild, sildenafil; Icar, icariin; SEM, standard error of the mean.

Figure 3 PDE5-inhibitors combined with Leu increases glucose utilization in vitro.

Notes: Differentiated C2C12 muscle cells or 3T3-L1 adipocytes were incubated with or without indicated treatments for 24 hours. The ECAR was measured after glucose (10 mM final) injection and the AUC calculated for a 2-hour period. Data are presented as % change from control (cells maintained in media without treatments) and expressed as mean ± SD (n=4). * indicates significant difference to control (P<0.05).
Abbreviations: PDE5, phosphodiesterase 5; ECAR, extracellular acidification rate; AUC, area under the curve; Sild, sildenafil; Leu, leucine; SD, standard deviation.

Figure 4 PDE5-inhibitors combined with Leu increases insulin signaling in vitro.

Notes: HepG2 cells were treated with Sild (1 nM)–Leu (0.5 mM) for 2 hours and stimulated with insulin (100 nM) for 20 minutes. Representative Western blot data of (A) P-IRS and IRS and (B) P-AKT and AKT and the quantification of their ratios are shown. Data are expressed as mean ± SEM (n=3).
Abbreviations: Ins, insulin; PDE5, phosphodiesterase 5; CTRL, control; Sild, sildenafil; Leu, leucine; SEM, standard error of the mean; P-IRS, phosphorylated insulin receptor substrate; P-AKT, phosphorylated protein kinase B.

Figure 5 Body weight measurements of the DIO-mice.

Abbreviations: DIO, diet-induced obese; LFD, low-fat diet; HFD, high-fat diet; Leu, leucine; Icar, icariin; SEM, standard error of the mean.

Figure 6 Leu and Icar combination lowers plasma glucose and insulin levels in DIO-mice.

Notes: Postprandial glucose (A) and insulin (B) as well as fasting glucose (C) and insulin (D) were assessed in DIO-mice fed an HFD with indicated treatments for 6 weeks. Data are presented as means ± SEM (n=10).
Abbreviations: DIO, diet-induced obese; HFD, high-fat diet; LFD, low-fat diet; Leu, leucine; Icar, icariin; ns, not significant; SEM, standard error of the mean.

Figure 7 Leu and Icar combination improves insulin sensitivity in DIO-mice.

Notes: GTT and ITT were performed in DIO-mice fed an HFD with indicated treatments for 6 weeks. Glucose levels were measured at 15 minutes, 30 minutes, 60 minutes, 90 minutes, and 120 minutes after glucose injection for GTT (A) or insulin injection for ITT (C). The AUC from GTT (B) and the change in glucose response from baseline at 30 minutes after insulin injection (D) were calculated. Data are presented as means ± SEM (n=10).
Abbreviations: DIO, diet-induced obese; GTT, glucose tolerance test; ITT, insulin tolerance test; LFD, low-fat diet; HFD, high-fat diet; Leu, leucine; Icar, icariin; AUC, area under the curve; SEM, standard error of the mean.

Figure 8 Leu and Icar combination promotes muscle fatty acid oxidation in DIO-mice.

Notes: Gene expression of genes promoting fatty acid oxidation was assessed in muscle of DIO-mice fed an HFD with indicated treatments for 6 weeks. *Significantly different to the other groups as indicated by the P-values. Data are expressed as fold change from LFD-control and represented as mean ± SEM (n=10).
Abbreviations: Leu, leucine; Icar, icariin; DIO, diet-induced obese; HFD, high-fat diet; LFD, low-fat diet; PPARα, peroxisome proliferator-activated receptor alpha; COX1, cyclooxygenase 1; ACOX1, acyl-CoA oxidase; CPT1B, carnitine palmitoyltransferase 1B; SEM, standard error of the mean; ns, not significant.

Figure 9 Leu and Icar combination inhibits hepatic lipogenesis and promotes hepatic fatty acid oxidation in DIO-mice.

Notes: DIO-mice were fed an HFD with indicated treatments for 6 weeks. At the end of the treatment period plasma CRP (A), and gene expression of IL-1β (B), TNFα (C), IL-6 (D) and MCP1 (E) in liver tissue were measured. Data are represented as mean ± SEM (n=10).
Abbreviations: Leu, leucine; Icar, icariin; DIO, diet-induced obese; HFD, high-fat diet; CRP, C-reactive protein; IL-1β, inflammatory markers interleukin-1 beta; TNFα, tumor necrosis factor alpha; IL-6, interleukin 6; MCP1, monocyte chemotactic protein 1; LFD, low-fat diet; SEM, standard error of the mean; ns, not significant.

Figure 10 Leu and Icar combination prevents hepatic steatosis in DIO-mice.

Notes: (A) Gene expression of the lipogenic genes ACC, FAS, and SCD1 and (B) gene expression of genes promoting fatty acid oxidation (PPARα, ACOX1, COX1, and CPT1A were assessed in liver of DIO-mice fed an HFD with indicated treatments for 6 weeks). Data are expressed as fold change from LFD-control and represented as mean ± SEM (n=10).
Abbreviations: Leu, leucine; Icar, icariin; DIO, diet-induced obese; ACC, acetyl CoA carboxylase; FAS, fatty acid synthase; SCD1, stearoyl-CoA desaturase-1; PPARα, peroxisome proliferator-activated receptor alpha; ACOX1, acyl-CoA oxidase; COX1, cyclooxygenase 1; CPT1A, carnitine palmitoyltransferase 1A; HFD, high-fat diet; LFD, low-fat diet; SEM, standard error of the mean; ns, not significant.

Figure 11 Leu and Icar combination suppresses inflammation in liver of DIO-mice.

Notes: DIO-mice were fed an HFD with indicated treatments for 6 weeks. (A) Liver mass and (B) representative liver histology sections to visualize fat accumulation at the end of the treatment period are shown. *Significantly different from HFD. Data are presented as means ± SEM (n=10).
Abbreviations: Leu, leucine; Icar, icariin; DIO, diet-induced obese; HFD, high-fat diet; LFD, low-fat diet; SEM, standard error of the mean; ns, not significant.

Figure 12 Summary of the three-way interaction among AMPK, SIRT1, and eNOS.

Notes: AMPK and SIRT1 exhibit a bidirectional interaction in response to cellular energy status and regulate lipid metabolism and inflammatory status. The eNOS–NO–cGMP pathway merges with the AMPK/SIRT1 pathway through activation of eNOS by AMPK phosphorylation of Ser1177 and by SIRT1 deacetylation of Lys 496 and 506. SIRT1, in turn, is stimulated by the eNOS-mediated increase in NO, thus creating a three-component loop. While HFD or caloric excess inhibit the AMPK/SIRT1 pathway and consecutively eNOS activity, caloric excess or leucine act as activators of this pathway. PDE5-inhibitors increase eNOS activity by yet unknown mechanisms, thereby also indirectly stimulating AMPK/SIRT1 downstream effects. In addition, PDE5-inhibitors increase cGMP levels and consecutively PKG, which also regulates inflammation. Thus, leucine combined with PDE5-inhibitors act together to reverse the inhibitory effects of HFD and caloric excess on the AMPK/SIRT1 pathway.
Abbreviations: eNOS, endothelial nitric oxide synthase; AMPK, AMP-activated protein kinase; NO, nitric oxide; PKG, cGMP-activated protein kinase; HFD, high-fat diet; PDE5, phosphodiesterase 5 inhibition; PGC1α, peroxisome proliferator-activated receptor γ co-activator α; PPARα, peroxisome proliferator-activated receptor alpha; SCD1, stearoyl-CoA desaturase-1; ACC, acetyl CoA carboxylase; FAS, fatty acid synthase; TNFα, tumor necrosis factor alpha; NFκβ, nuclear factor-kappaB; MCP1, monocyte chemotactic protein 1; IL-1β, interleukin-1 beta; IL-6, interleukin 6; FA, fatty acid.