Genotypic distribution of multidrug-resistant and extensively drug-resistant tuberculosis in northern Thailand

Figures & data

Table 1 Frequency of genetic site mutations of katG, inhA, ahpC, and rpoB genes in 34 M/XDR-TB isolates

katG	n (%)	inhA	n (%)	ahpC	n (%)	rpoB	n (%)
katG 229	1 (2.9)	inhA 14	11 (32.4)	ahpC 10	4 (11.8)	rpoB 445	8 (23.5)
katG 300	1 (2.9)	inhA 25	1 (2.9)	ahpC 12	4 (11.8)	rpoB 450	6 (17.7)
katG 302	1 (2.9)	inhA 78	8 (23.5)	ahpC 20	4 (11.8)	rpoB 464	6 (17.7)
katG 308	3 (8.8)	inhA 81	7 (20.6)	ahpC 22	3 (8.8)	rpoB 483	4 (11.8)
katG 310	3 (8.8)	inhA 84	9 (26.5)	ahpC 75	7 (20.6)	rpoB 490	7 (20.6)
katG 312	4 (11.8)	inhA 86	8 (23.5)	ahpC 76	6 (17.7)	rpoB 493	4 (11.8)
katG 314	1 (2.9)	inhA 94	3 (8.8)			rpoB 507	9 (26.5)
katG 315	12 (35.3)	inhA 114	11 (32.4)			rpoB 508	9 (26.5)
katG 320	1 (2.9)
katG 340	4 (11.8)
katG 343	7 (20.6)

Abbreviation: M/XDR-TB, multidrug/extensively drug-resistant tuberculosis.

Table 2 Distribution of Mycobacterium tuberculosis genetic mutations with isoniazid and rifampicin resistance

Gene mutation codon	n	%
katG
No mutation	14	41.3
katG 315	9	26.7
katG 320	1	2.9
katG 312	1	2.9
katG 343	1	2.9
katG 315 and katG 343	1	2.9
katG 308 and katG 310	1	2.9
katG 312 and katG 343	2	5.9
katG 308, katG 315, and katG 340	1	2.9
katG 315, katG 340, and katG 343	1	2.9
katG 310, katG 314, katG 340, and katG 343	1	2.9
katG 299, katG 300, katG 302, katG 310, and katG 312	1	2.9
InhA
No mutation	7	20.6
inhA 14	6	17.7
inhA 25	1	2.9
inhA 86	1	2.9
inhA 114	5	14.8
inhA 14 and inhA 114	4	11.8
inhA 84 and inhA 114	1	2.9
inhA 78, inhA 81, and inhA 84	1	2.9
inhA 78, inhA 81, and inhA 86	1	2.9
inhA 78, inhA 84, and inhA 86	1	2.9
inhA 14, inhA 78, inhA 81, and inhA 84	1	2.9
inhA 78, inhA 81, inhA 84, and inhA 86	1	2.9
inhA 78, inhA 84, inhA 86, and inhA 114	1	2.9
inhA 81, inhA 84, inhA 86, and inhA 94	1	2.9
inhA 78, inhA 81, inhA 84, inhA 86, and inhA 94	2	5.9
ahpC
No mutation	21	61.8
ahpC 10	1	2.9
ahpC 75	1	2.9
ahpC 10 and ahpC 12	1	2.9
ahpC 12 and ahpC 20	1	2.9
ahpC 75 and ahpC 76	6	17.7
ahpC 10, ahpC 20, and ahpC 22	1	2.9
ahpC 12, ahpC 20, and ahpC 22	1	2.9
ahpC 10, ahpC 12, ahpC 20, and ahpC 22	1	2.9
rpoB
No mutation	6	17.7
rpoB 445	2	5.9
rpoB 508	1	2.9
rpoB 464	2	5.9
rpoB 450	3	8.8
rpoB 490	2	5.9
rpoB 507	3	8.8
rpoB 445 and rpoB 508	1	2.9
rpoB 507 and rpoB 508	6	17.7
rpoB 445 and rpoB 483	1	2.9
rpoB 464 and rpoB 483	1	2.9
rpoB 445, rpoB 464, and rpoB 504	1	2.9
rpoB 445, rpoB 490, and rpoB 493	1	2.9
rpoB 450, rpoB 490, and rpoB 493	1	2.9
rpoB 445, rpoB 464, rpoB 490, and rpoB 493	1	2.9
rpoB 450, rpoB 490, rpoB 483, and rpoB 493	1	2.9
rpoB 445, rpoB 464, rpoB 490, rpoB 483, and rpoB 493	1	2.9

Table 3 Raw distribution of genetic site mutations of katG, inhA, ahpC, and rpoB genes in M/XDR-TB isolates

No.	katG 299	katG 300	katG 302	katG 308	katG 310	katG 312	katG 314	katG 315	katG 320	katG 340	katG 343	inhA 14	inhA 25	inhA 78	inhA 81	inhA 84	inhA 86	inhA 94	inhA 114	ahpC 10	ahpC 12	ahpC 20	ahpC 22	ahpC 75	ahpC 76	rpoB 445	rpoB 450	rpoB 464	rpoB 483	rpoB 490	rpoB 493	rpoB 507	rpoB 508
1	Y	Y	Y	Y	Y	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	Y
2	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	Y	–	–	–	–	Y
3	–	–	–	–	–	–	–	–	–	–	Y	–	Y	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	Y	–	–	–
4	–	–	–	–	–	Y	–	–	–	–	Y	–	–	–	–	Y	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y
5	–	–	–	Y	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–
6	–	–	–	–	–	–	–	Y	–	–	–	Y	–	–	–	–	–	–	Y	–	–	–	–	–	–	Y	–	–	Y	–	–	–	–
7	–	–	–	–	–	–	–	Y	–	Y	Y	Y	–	–	–	–	–	–	Y	–	Y	Y	Y	–	–	Y	–	Y	Y	Y	Y	–	–
8	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	Y	Y	Y	Y	Y	–	–	–	–	–	–	–	–	–	–
9	–	–	–	–	–	–	–	Y	–	–	Y	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	Y	Y	–	–
10	–	–	–	–	–	Y	–	–	–	–	Y	–	–	Y	Y	Y	Y	–	–	–	–	–	–	–	–	Y	–	–	–	Y	Y	–	–
11	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y	–	–	–	–	–	–	–	–
12	–	–	–	Y	–	–	–	Y	–	Y	–	Y	–	–	–	–	–	–	–	Y	–	Y	Y	–	–	–	–	–	–	–	–	Y	Y
13	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	Y	–
14	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	Y	Y	Y	–	–	–	–	Y	–	–	–	–	–	–	–
15	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	Y	Y	–	–	–	–	–	–	–	–
16	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–
17	–	–	–	–	–	Y	–	–	–	Y	Y	–	–	Y	–	Y	Y	–	Y	–	–	–	–	–	–	–	Y	–	Y	Y	Y	–	–
18	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–
19	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–
20	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	Y	Y	–	–	–	–	–	–	Y	–	Y	Y	Y	–	Y	–	–	–
21	–	–	–	–	–	–	–	–	–	–	–	Y	–	Y	Y	Y	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–
22	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	Y	–	–	–	–	–	–
23	–	–	–	–	Y	–	Y	–	–	Y	Y	–	–	Y	Y	Y	Y	Y	–	–	Y	Y	–	–	–	–	Y	–	–	–	–	–	–
24	–	–	–	–	–	–	–	Y	–	–	–	–	–	Y	Y	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y
25	–	–	–	–	–	–	–	Y	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y
26	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y
27	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y
28	–	–	–	–	–	–	–	Y	–	–	–	–	–	Y	Y	Y	Y	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y
29	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y	Y	–	–	–	–	–	–	–	–	–	–	–	Y	Y	–	–	–	–
30	–	–	–	–	–	–	–	–	Y	–	–	–	–	–	Y	Y	Y	Y	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	–
31	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y	–	–	Y	–	–	–	–	–
32	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	Y	–	–	–	–	–	–	Y	–
33	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	Y	Y	–	–	–	–	–	–	Y	–
34	–	–	–	–	–	–	–	Y	–	–	–	–	–	–	–	–	–	–	Y	–	–	–	–	Y	Y	–	–	–	–	–	–	–	–

Notes: -, no mutation; Y, presence of mutation; gray column, proposed mutation test panels.

Abbreviation: M/XDR-TB, multidrug/extensively drug-resistant tuberculosis.

Table 4 Distribution of genetic mutation for isoniazid and rifampicin resistance

Countries	katG (n %), top 3 common loci	inhA (n %), top 3 common loci	ahpC (n %), top 3 common loci	rpoB (n %), top 3 common loci
Thailand (the present study) in the north of Thailand	20/34 (58.8%) 315, 343, 312, 340	27/34 (79.4%) 14, 114, 84	13/34 (38.2%) 75, 76, 10, 12, 20	28/34 (82.3%) 507, 508, 445
Thailand^Citation32 (in the middle of Thailand in 2007)	25/29 (86.21%) 315, 463, 308	7/25 (24.0%) (−15), (−8), 21	NA	NA
Myanmar^Citation33	31/33 (72.1%) 315	2/33 (4.7%) (−15)	NA	32/33 (97.0%) 531, 526, 516
People’s Republic of China^Citation34	178/242 (73.9%) 315, 295, 299	26/242 (10.7%) (15), (−8), 25	22/242 (9.1%) (−10), (−6), (−12)	213/242 (88.0%) 531, 526, 516
Poland^Citation35	40/50 (80%) 315, 463, 234	8/50 (16%) (−15), (−8), 289	5/50 (10%) 48, 54, 57	NA
Switzerland^Citation36	101/154 (65.6%) 315	35/154 (22.7%) (−15)	NA	NA
Argentina^Citation37	43/71 (60.5%) 315	16/71 (22.5%) (−15)	NA	NA
South Africa^Citation38	NA	165/232 (71%) (−15), (−8)	NA	NA
Morocco^Citation39	15/16 (93.7%) 315	1/16 (6.2%) (−15)	NA	21/26 (80.8%) 531, 316, 513, 526
India, Moldova, Philippines, and South Africa^Citation40	268/316 (84.8%) 315	101/316 (32.0%) (−15), (−8), (−17)	NA	NA

Abbreviation: NA, not available.

Table S1 Primers used for sequencing

Gene	Primer	Nucleotide sequencing (5′–3′)	Product size (pb)	Temperature (°C)	Reference
katG	MtkatGf	ACCCGAGGCTGCTCCGCTGG	168	94°C – 20 s 50°C – 20 s 70 cycles 72°C – 20 s	Afanas’ev^Citation1
	MtkatGr	CAGCTCCCACTCGTAGCCGT
inhA	MtfabGf	GCCTCGCTGGCCCAGAAAGG	320	94°C – 20 s 56°C – 20 s 70 cycles 72°C – 20 s	Afanas’ev^Citation1
	MtfabGr	CTCCGGATCCACGGTGGGT
ahpC	ahpC1 F	GCCTGGGTGTTCGTCACTGGT	359	95°C – 40 s 15 min (start) 94°C – 40 s 30 cycles 57°C – 40 s 1 min 72°C – 40 s 15 min (final)	Valvatne^Citation2
	ahpC2 R	CGCAACGTCGACTGGCTCATA
rpoB	MtrpoBf	GAGGCGATCACCGCAGAC	321	94°C – 20 s 59°C – 20 s 70 cycles 72°C – 20 s	Afanas’ev^Citation1
	MtrpoBr	GGTACGGCGTTTCGATGAAC

KhadkaDKEampokalapBPanitchakornJRamasootaPKhusmithSMultiple mutations in katG and inhA identified in Thai isoniazid-resistant Mycobacterium tuberculosis isolatesSoutheast Asian J Trop Med Public Health200738237638217539290

 PubMedGoogle Scholar

AungWWEiPWNyuntWWPhenotypic and genotypic analysis of anti-tuberculosis drug resistance in Mycobacterium tuberculosis isolates in MyanmarAnn Lab Med201535549449926206685

 PubMed Web of Science ®Google Scholar

LuoTZhaoMLiXSelection of mutations to detect multidrug-resistant Mycobacterium tuberculosis strains in Shanghai, ChinaAntimicrob Agents Chemother20105431075108120008778

 PubMed Web of Science ®Google Scholar

JagielskiTBakułaZRoeskeKDetection of mutations associated with isoniazid resistance in multidrug-resistant Mycobacterium tuberculosis clinical isolatesJ Antimicrob Chemother20146992369237524855126

 PubMed Web of Science ®Google Scholar

FennerLEggerMBodmerTSwiss HIV Cohort Study and the Swiss Molecular Epidemiology of Tuberculosis Study GroupEffect of mutation and genetic background on drug resistance in Mycobacterium tuberculosisAntimicrob Agents Chemother20125663047305322470121

 PubMed Web of Science ®Google Scholar

ImperialeBRZumárragaMJDi GiulioABCataldiAAMorcilloNSMolecular and phenotypic characterisation of Mycobacterium tuberculosis resistant to anti-tuberculosis drugsInt J Tuberc Lung Dis20131781088109323827034

 PubMed Web of Science ®Google Scholar

NiehausAJMlisanaKGandhiNRMathemaBBrustJCHigh prevalence of inhA promoter mutations among patients with drug-resistant tuberculosis in KwaZulu-Natal, South AfricaPLoS One2015109e013500326332235

 PubMed Web of Science ®Google Scholar

ZakhamFChaouiIEchchaouiAHDirect sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in MoroccoInfect Drug Resist2013620721324399879

 PubMedGoogle Scholar

TorresJNPaulLVRodwellTCNovel katG mutations causing isoniazid resistance in clinical M. tuberculosis isolatesEmerg Microbes Infect201547e4226251830

 PubMed Web of Science ®Google Scholar

Afanas’evMVIkryannikovaLNIl’inaENMolecular characteristics of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis isolates from the Russian FederationJ Antimicrob Chemother20075961057106417442757

 PubMed Web of Science ®Google Scholar

ValvatneHSyreHKrossMIsoniazid and rifampicin resistance-associated mutations in Mycobacterium tuberculosis isolates from Yangon, Myanmar: implications for rapid molecular testingJ Antimicrob Chemother200964469470119710078

 PubMed Web of Science ®Google Scholar