Novel single-nucleotide variations associated with vancomycin resistance in vancomycin-intermediate Staphylococcus aureus

Figures & data

Table 1 MRSA strains used in this study

Vancomycin phenotype (number)	Source^a (number)	Strain IDs	Reference
VSSA (30)	CGMH (30)	43, 46, 49, 64, 827-851	This study
hVISA (41)	CGMH (34)	2, 6, 9, 10, 22, 23, 33, 37, 42, 50, 55, 57, 60, 62, 72, 75, 82, 85, 103, 104, 108, 199, 208, 215, 216, 222, 224, 232, 236, 238, 241, 246, 247, 250	This study
~	TSGH (2)	5046, 5047	1, 2
	NTUH (3)	9140, 9148, 9095
	CMMC (2)	2012, 2086
VISA (16)	CGMH (8)	36, 80, 852-857	This study
	TSGH (6)	188, 204, 205^b, 218, 243^b, 257	1, 3, 4
	CMUH (2)	2021, 4022	2

Notes: ^aAll strains were collected from blood cultures at different times. ^bWhole-genome sequenced strains.

Abbreviations: CGMH, Chang Gung Memorial Hospital; CMMC, Chi Mei Medical Center; CMUH, China Medical University Hospital; hVISA, heterogeneous vancomycin-intermediate Staphylococcus aureus; MRSA, methicillin-resistant Staphylococcus aureus; NTUH, National Taiwan University Hospital; TSGH, Tri-Service General hospital; VISA, vancomycin-intermediate Staphylococcus aureus; VSSA, vancomycin-sensitive Staphylococcus aureus.

Table 2 Primers used in this study

Primer	Sequence (5' → 3')
fmtC-FI	GGAGATCCGTTAGGTGATGAAA
fmtC-RI	TGGTAAATCTAACTCTGGCAACC
graRS-F	TAIIIIGGCCGATTTATTACTTTA
graSR-R	CCTTTAGGCTTTGGCACTTGT
htrA-F	GATTCAGACAGCTCGATGCAG
htrA-R	GGCCAATACATCATCCAAAAC
mecA-F	GTGGAGACGAGCACTAATAACC
mecA-R	GAAGTTGTAGCAGGAACACAAATG
pbp2-F	GAACTTGACTGGTGGATTTGG
pbp2-R	GCCCATCCACACTGACATAG
pbp4-40R	TACAGAAGGCATTTCGACG
pbp4-F1	AGTATGGACAATCGCAGACC
srtA-F	GCAGCATATTTGTTTGCTAAACC
srtA-R	CAATGACACGTCGTCATTGG
tcaA-R1	TCTTGCGAGCCTTGTTCAAG
tcaA-R-new	GCACCTACCAAGCAACCAAT
upps-F	TTATGGATGGTAATGGGCGA
upps-R	GCGTCTTTGACGTGACTGAT
vicK-F	GAGTATGCCAACCGTCAAGA
vicK-R	ACGATACGAATACGTCCACG
vraSR-F1	TCAGGTACACGTATCGAGGT
vraR-R1	TTGTCGGTGCTGAAATCAAT

Table 3 Sequence variations in VSSA and VISA strains

Gene ID	Genename	Amino acid variation (nucleotide variation)	VSSA	VSSA	VISA	VISATSGH243(MIC=4)
			N315	JH1	TSGH243(MIC=4)	TSGH243(MIC=4)
SA1193	fmtC	Q692E (C2074G)	Q	Q	E	E
SA0614	graR	D148Q (G442C, T444G)	D	D	Q	Q
SA0615	graS	L26F (G78C)	L	L	F	F
		159L (A175T)	I	I	L	L
		T224I (C671T)	T	T	I	I
SA0879	htrA	T278I (C833T)	T	T	I	I
		P306L(T917C)	L	L	P	P
		1311T (T932C)	I	I	T	T
SA0038	mecA	N146K (T438A)	N	N	K	K
		N204K (T612G)	N	N	K	K
		G246E (G738A)	G	G	E	E
SA1283	pbp2	C197Y (G591A)	C	Y	Y	Y
		A420V (C1259T)	A	A	V	V
		A557T (G1669A)	A	A	T	T
SA0598	pbp4	S189T (T565A)	S	S	T	T
		S395C (A1183T)	S	S	C	C
		A409T (G1225A)	A	A	T	T
SA2316	srtA	N57K (T171A)	N	N	K	K
		E167G (A500G)	E	E	G	G
SA246	tcaA	L218P (T653C)	L	P	P	P
		Y237H (T709C)	Y	Y	H	H
		T262S (A784T)	T	T	S	S
		R283H (A848G)	R	R	R	H
		G312D (G935A)	G	G	G	D
SA1103	upps	163V (A187G)	I	I	V	V
		K101E (A301G)	K	K	E	E
SA1700	vraR	E59D (A177T)	E	E	E	D
SA0018	vicK	R222K (G665A)	R	R	K	K

Note: Sequences in bold typeface have been reported in previous studies.

Abbreviations: TSGH, Tri-Service General hospital; VISA, vancomycin-intermediate Staphylococcus aureus; VSSA, vancomycin-sensitive S. aureus.

Table 4 Amino acid sequence variations in 16 MRSA isolates

Types	Amino acid	VSSA (5)					hVISA (9)									VISA (2)
CGMH strain		43	46	234	49	64	33	250	236	241	10	50	60	215	246	36	80
VAN MIC		1	1	2	1.5	1	2	2	2	2	2	2	2	2	2	2	2
PAP/AUC		0.82	0.65	0.73	0.83	0.69	0.94	0.91	1.14	0.93	1.2	0.91	0.98	1	0.95	1.47	1.37
fmtC	Q692E	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
graR	D148Q	-	-	-	+	+	-	-	-	+	+	+	+	+	+	+	+
graS	L26F	-	-	-	+	+	-	-	+	-	+	+	+	+	+	+	+
	159L	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
	T224I	-	-	-	+	+	-	-	+	+	+	+	+	+	+	+	+
htrA	T278I	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
	P306L	-	-	+	+	+	-	-	-	+	+	+	+	+	+	+	+
	1311T	-	-	+	+	+	-	-	-	+	+	+	+	+	+	+	+
mecA	N146K	-	-	+	+	+	-	-	-	-	+	+	+	+	+	+	+
	N204K	-	-	+	+	+	-	-	-	-	+	+	+	+	+	+	+
	G246E	-	-	+	+	+	-	-	-	+	+	+	+	+	+	+	+
pbp2	C197Y	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
	A420V	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
	A557T	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
pbp4	S189T	-	-	-	+	+	-	+	-	-	+	+	+	+	+	+	+
	S395C	-	-	-	+	+	-	+	-	-	+	+	+	+	+	+	+
	A409T	-	-	-	+	+	-	+	-	-	+	+	+	+	+	+	+
srtA	N57K	-	-	+	+	+	-	-	+	+	+	+	+	+	+	+	+
	E167G	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
tcaA	L218P	-	-	+	+	+	-	+	-	+	+	+	+	+	+	+	+
	Y237H	-	-	-	+	+	-	+	-	+	+	+	+	+	+	+	+
	T262S	-	-	-	+	+	-	+	-	+	+	+	+	+	+	+	+
	R283H	-	-	-	+	+	-	+	-	-	+	+	+	+	+	+	+
	G312D	-	-	+	+	+	-	+	+	-	+	+	+	+	+	+	+
upps	163V	-	-	+	+	+	-	-	+	+	+	+	+	+	+	+	+
	K101E	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
vraR	E59D	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+
vicK	R222K	-	-	-	+	+	-	-	-	-	+	+	+	+	+	+	+

Notes: Sequences in bold typeface have been reported in previous studies. Minus sign (−): sequence identical to that of N315; plus sign (+): sequence different from that of N315.

Abbreviations: CGMH, Chang Gung Memorial Hospital; hVISA, heterogeneous vancomycin-intermediate Staphylococcus aureus; MRSA, methicillin-resistant S. aureus; PAP/AUC, population analysis profile and area under the curve ratio; VISA, vancomycin-intermediate S. aureus; VSSA, vancomycin-sensitive S. aureus.

Table 5 Amino acid sequence variations in 30 VSSA isolates

Strain ID	Amino acid sequence variations
	FmtC	HtrA			Upps
	Q692E	T278I	P306L	1311T	163V	K101E
CGMH43	-	-	-	-	-	-
CGMH46	-	-	-	-	-	-
CGMH234	-	-	+	+	+	-
CGMH49	+	+	+	+	+	+
CGMH64	+	+	+	+	+	+
CGMH827	-	-	-	-	+	-
CGMH828	-	-	+	+	+	-
CGMH829	-	-	+	+	+	-
CGMH830	-	-	+	+	+	-
CGMH83I	+	+	+	+	+	-
CGMH832	-	-	-	-	-	-
CGMH833	-	-	-	+	+	-
CGMH834	-	-	+	+	+	-
CGMH835	-	-	+	+	+	-
CGMH836	-	-	+	+	+	-
CGMH837	-	-	-	-	-	-
CGMH838	-	-	+	+	+	-
CGMH839	-	-	+	+	+	-
CGMH840	-	-	+	+	+	-
CGMH84I	-	-	+	+	+	-
CGMH842	-	-	+	+	-	-
CGMH843	-	-	+	+	+	-
CGMH844	-	-	+	+	+	-
CGMH845	-	-	+	+	+	-
CGMH846	-	-	-	-	-	-
CGMH847	-	-	+	+	+	-
CGMH848	-	-	+	+	-	-
CGMH849	-	-	+	+	+	-
CGMH850	-	-	+	+	+	-
CGMH85I	+	+	+	+	+	+
	13.3%	13.3%	86.7%	86.7%	76.7%	10.0%

Notes: Minus sign (−): sequence identical to that of N315; plus sign (+): sequence different from that of N315.

Abbreviations: CGMH, Chang Gung Memorial Hospital; S. aureus, Staphylococcus aureus; VSSA, vancomycin-sensitive S. aureus.

Table 6 Amino acid sequence variations in 41 hVISA isolates

Strain ID	Amino acid sequence variations
	FmtC	HtrA			Upps
	Q692E	T278I	P306L	1311T	163V	K101E
P-value^a	4.4×10^-9	4.4×10^-9	0.0I	0.2	0.05	5.1 × 10^-10
CGMH33	-	-	-	-	-	-
CGMH250	-	-	-	-	-	-
NTUH9148	-	-	+	+	+	-
CGMH2	+	+	+	+	+	+
CGMH6	+	+	+	+	+	+
CGMH9	+	+	+	+	+	+
CGMH10	+	+	+	+	+	+
CGMH22	+	+	+	+	+	+
CGMH23	+	+	+	+	+	+
CGMH37	+	+	+	+	+	+
CGMH42	+	+	+	+	+	+
CGMH50	+	+	+	+	+	+
CGMH55	+	+	+	+	+	+
CGMH57	+	+	+	+	+	+
CGMH62	+	+	+	+	+	+
CGMH75	+	+	+	+	+	+
CGMH82	+	+	+	+	+	+
CGMH85	+	+	+	+	+	+
CGMH103	+	+	+	+	+	+
CGMH104	+	+	+	+	+	+
CGMH108	+	+	+	+	+	+
CGMH199	+	+	+	+	+	+
CGMH208	+	+	+	+	+	+
CGMH215	+	+	+	+	+	+
CGMH216	+	+	+	+	+	+
CGMH222	+	+	+	+	+	+
CGMH224	+	+	+	+	+	+
CGMH232	+	+	+	+	+	+
CGMH238	+	+	+	+	+	+
CGMH246	+	+	+	+	+	+
CGMH247	+	+	+	+	+	+
NTUH9095	+	+	+	+	+	+
TSGH5046	+	+	+	+	+	+
TSGH5047	+	+	+	+	+	+
CMMC2012	+	+	+	+	+	+
CMMC2086	+	+	+	+	+	+
NTUH9140	+	+	+	+	+	+
CGMH236	-	-	-	-	+	-
CGMH60	+	+	+	+	+	+
CGMH72	+	+	+	+	+	+
CGMH24I	-	-	+	+	+	-
	87.8%	87.8%	92.7%	92.7%	95.I%	87.8%

Notes: Minus sign (−): sequence identical to that of N315; plus sign (+): sequence different from that of N315. ^aP values were generated by the Student’s t-test by comparing the data from VISA and hVISA isolates.

Abbreviations: CGMH, Chang Gung Memorial Hospital; CMMC, Chi Mei Medical Center; hVISA, heterogeneous vancomycin-intermediate Staphylococcus aureus; NTUH, National Taiwan University Hospital; TSGH, Tri-Service General hospital; VISA, vancomycin-intermediate S. aureus.

Table 7 Amino acid sequence variations in 16 VISA isolates

Strain ID	Amino acid sequence variations
	FmtC	HtrA			Upps
	Q692E	T278I	P306L	1311T	163V	K101E
P-value^a	4.2×10^-5	1.2×10^-6	0.01	0.01	0.1	1.8×10^-5
CGMH36	+	+	+	+	+	+
CGMH80	+	+	+	+	+	+
CMUH4022	+	+	+	+	+	+
CGMH852	+	+	+	+	+	+
CGMH853	-	-	+	+	+	-
CGMH854	+	+	+	+	+	+
CGMH855	+	+	+	+	+	+
CGMH856	+	+	+	+	+	+
CGMH857	-	+	+	+	-	-
CMUH2021	+	+	+	+	+	+
TSGH188	+	+	+	+	+	+
TSGH204	+	+	+	+	+	+
TSGH205	+	+	+	+	+	+
TSGH218	+	+	+	+	+	+
TSGH243	+	+	+	+	+	+
TSGH257	+	+	+	+	+	+
	87.50%	93.80%	100%	100%	93.80%	87.50%

Notes: Minus sign (−): sequence identical to that of N315; plus sign (+): sequence different from that of N315. ^aP values were generated by the Student’s t-test by comparing the data from VSSA and VISA isolates.

Abbreviations: CGMH, Chang Gung Memorial Hospital; CMUH, China Medical University Hospital; TSGH, Tri-Service General Hospital; VISA, vancomycin-intermediate Staphylococcus aureus; VSSA, vancomycin-sensitive S. aureus.

Table S1 Comparative analysis gene list

Accessionnumber	Genename	Location	Gene function	Gene mutation type	Reference
SA1843	agrC	2080353-2081468	Accessory gene regulator C	SNP (L193stop)	4
SA0366	ahpC	422549-423118	Alkyl hydroperoxide reductase subunit C	Transcriptome analysis data	22
SA1226	asd	1401012-1402001	Aspartate semialdehyde dehydrogenase	Transcriptome analysis data	16
SA1557	ccpA	1784194— 1785138	Catabolite control protein A	Knock out deletion	15
SA0723	clpP	827630-828217	ATP-dependent Clp protease proteolytic subunit	Truncating deletion, SNP (MIV, H83R, R152H)	20
SA1096	clpQ	1242040—1242585	Heat shock protein HslV	Transcriptome analysis data	16
SA0480	ctsR	560629—561090	Transcription repressor of class III stress genes homologue	Transcriptome analysis data	20
SA0639	cydC	731989-733620	Hypothetical protein, similar to ABC transporter required for expression of cytochrome bd	Transcriptome analysis data	20
SA0640	cydD	733617-735290	Hypothetical protein, similar to ABC transporter required for expression of cytochrome bd	Transcriptome analysis data	20
SA1228	dapB	1402887-1403609	Dihydrodipicolinate reductase	Transcriptome analysis data	16
SA1206	fmtA	1379204-1380466	Factor essential for expression of methicillin	Transcriptome analysis data	21
SA1193	fmtC	1363612-1366134	Oxacillin resistance-related FmtC protein	Transcriptome analysis data	10
SA0309	geh	365458-367533	Glycerol ester hydrolase	Transcriptome analysis data	16
SA0430	gltB	490664-495163	Glutamate synthase large subunit	Transcriptome analysis data	16
SA0614	graR	708245-708919	Hypothetical protein, similar to two-component response regulator	SNP (TIIA, E15K, S79F, D148Q, F151L, N197S)	9
SA0615	graS	708912-709952	Hypothetical protein, similar to two-component sensor histidine kinase	SNP (L26F, 159L, T2241)	9
SA0879	htrA	997117-999426	Serine protease HtrA	Transcriptome analysis data	10
SA1859	ilvB	2099308-2101077	Acetolactate synthase large subunit	Transcriptome analysis data	16
SA0980	isdE	1109815-I110693	Hypothetical protein, similar to ferrichrome ABC transporter	SNP (A48V)	17
SA1997	lacA	complement(2268598-2269026)	Galactose-6-phosphate isomerase LacA subunit	Transcriptome analysis data	16, 20
SA1996	lacB	complement(2268067-2268582)	Galactose-6-phosphate isomerase LacB subunit	Transcriptome analysis data	16, 20
SA1995	lacC	complement(2267122-2268054)	Tagatose-6-phosphate kinase	Transcriptome analysis data	16, 20
SA1994	lacD	complement(2266138-2267118)	Tagatose-I,6-diphosphate aldolase	Transcriptome analysis data	16, 20
SA2103	lytR	2365947-2366894	Hypothetical protein, similar to lyt divergon expression	Transcriptome analysis data	10
SA0038	mecA	complement (45031-47037)	Penicillin-binding protein 2 prime	Transcriptome analysis data	10
SA0344	metE	complement (401175-403403)	5-Methyltetrahydropteroyltriglutamate- homocysteine methyltransferase	Transcriptome analysis data	10
SA0641	MgrA	complement(735417-735860)	Hypothetical protein; regulatory protein involved in autolytic activity	Deletion	10
SA0997	murl	1130843-1131643	Glutamate racemase	Transcriptome analysis data	10
SA1926	murZ	complement(2174362-2175621)	UDP-N-acetylglucosamine I-carboxylvinyl transferase 2	Transcriptome analysis data	10
SA0847	oppD	960028-961110	Oligopeptide transport system ATP-binding protein OppD homolog	Transcriptome analysis data	10
SA2237	opuCA	complement(2511766-2512998)	Glycine betaine/carnitine/choline ABC transporter opuCA	Transcriptome analysis data	10
SA2236	opuCB	complement (2511134—2511769)	Glycine betaine/carnitine/choline ABC transporter opuCB	Transcriptome analysis data	10
SA2235	opuCC	complement(2510176-251I117)	Glycine betaine/carnitine/choline ABC transporter opuCC	Transcriptome analysis data	10
Accessionnumber	Genename	Location	Gene function	Gene mutation type	Reference
SA2234	opuCD	complement(2509481-2510176)	Glycine betaine/carnitine/choline ABC transporter opuCD	Transcriptome analysis data	10
SA1283	pbp2	1486656-1488839	Penicillin-binding protein 2	Overexpression	10
SA0598	pbp4	complement(690688-691983)	Penicillin binding protein 4	Overexpression/allelic replacement inactivation	10
SA1024	pbpA	1158054—1160288	Penicillin-binding protein 1	Transcriptome analysis data	10
SA1659	prsA	1892718-1893680	Peptidyl-prolyl cis/trans isomerase homolog	Deletion frameshift mutation	10
SA0963	py^cA	1091242-1094694	Pyruvate carboxylase	Transcriptome analysis data	10
SA0500	rpoB	579620-583171	RNA polymerase beta chain	SNP (G171D, A447V, D471Y, H481Y)	4
SA1872	rsbU	complement(2119821-2120822)	SigmaB regulation protein RsbU	Transcriptome analysis data	14
SA2094	SA2094	complement(2353833-2355233)	Hypothetical protein, similar to Na+/H+ antiporter	SNP (A94T)	17
SA0573	SarA	666347-666721	Staphylococcal accessory regulator A	Transcriptome analysis data	10
SA1691	sgtB	complement(1938571-1939380)	Hypothetical protein, similar to penicillin-binding protein IA/IB	Transcriptome analysis data	10
SA0111	sirA	complement(127549-128541)	Iron-regulated ABC transporter	Transcriptome analysis data	20
SA0110	sirB	complement(126538-127533)	Iron-regulated ABC transporter siderophore permease protein SirB	Transcriptome analysis data	20
SA0109	sirC	complement(125543-126460)	Iron-regulated ABC transporter siderophore permease protein SirC	Transcriptome analysis data	20
SA0456	SpoVG	526376-526702	Stage V sporulation protein G homolog	Deletion	19
SA2316	srtA	complement(2600886-2601506)	Sortase	Transcriptome analysis data	10
SA0592	tagA	685072-685836	Teichoic acid biosynthesis protein	Transcriptome analysis data	23
SA2146	tcaA	complement(2411587-2412969)	TcaA protein	SNP (M202T, L218P, T2791, R283H, G312D)	9
SA0857	trfA	971601-972320	Hypothetical protein, similar to negative regulator of genetic competence MecA	Insertion inactivation	18
SA0858	trfB	972441-973427	Hypothetical protein, similar to transcription factor	Insertion inactivation	18
SA1103	upps	1248834-1249604	Undecaprenyl pyrophosphate synthetase	Point mutation on ribosome binding site	II
SA0018	vicK	25648-27474	Two-component response regulator	SNP (L10F, N48K, R222K/I, G275V, R282C, F330S, V3801, S437F, A468T, T492K, D496N, V494L, A567D)	20
SA0017	vicR	24928-25635	Two-component response regulator	Transcriptome analysis data	16
SA1700	vraR	complement(1946742-1947371)	Two-component response regulator	SNP (E59D, A113V, S164P, S329L)	9, 20
SA1701	vraS	complement(1947361-1948404)	Two-component response regulator	SNP (15N, G9V, G88D, T104A, L123H, S167N, F243S, A260V, K2721, A314V, L315M, 1317T, F321L, P327S)	9, 20
SA1095	xerC	1241147-1242043	Site-specific recombinase XerC homolog	Transcriptome analysis data	16
SA1702	SA1702	1948401-1949102	Conserved hypothetical protein	SNP (E56G, L861, Q136H)	9