Metabolic mechanism of ceftazidime resistance in Vibrio alginolyticus

Figures & data

Table 1 Primers for QRT-PCR

Gene	KEGG entry	primer	Sequence (5′-3′)
tesA tesB	N646_4268	Forward	AGCATTTCTGGCGATACAAC
		Reverse	GGAGGGAAACCTCTTAGGC
	N646_0021	Forward	CTTTGGATTCGTGCTAATGG
		Reverse	ATAGAGTGGTCAATGGTGGC
fadD	N646_3023	Forward	CTCTGATGATGCCAAACCTAC
		Reverse	ACGAGGAGTGTAAAGTGGGTT
fadE	N646_1395	Forward	TATCCCAACTGATGTCAAAGG
		Reverse	CAACCGACAGACACTCAACC
fadJ	N646_1310	Forward	GCGAACGCTAAGACAGAAACT
		Reverse	GCTGAAGTAATGCAAACCCAC
fadB	N646_2210	Forward	ACTGCCCAGGGTTCTTCG
		Reverse	CCAGCCAAACTTACGCTCC
fadA	N646_1311	Forward	CGAACAGTACGCCATTGACT
		Reverse	GCATAACCTCGGATGTAACC
fadA	N646_2209	Forward	TATTAGCCGTGAGCAACAAG
		Reverse	AATCACTTCGTCGTAATCCAG
atoB	N646_3909	Forward	GATGTTTGATACGGATGAATACC
		Reverse	ACGCCACGATAATCGCAC

Figure 1 Resistance of VA-R_CAZ to CAZ.

Notes: (A) MIC of CAZ in VA-S and VA-R_CAZ. Logarithmic phase of VA-S and VA-R 5 CAZ (10 colony-forming units) were incubated with 3% NaCl LB broth containing CAZ ranging from 0.05 to 100 μg/mL in microwell plate at 30°C for 16 hours. (B) Percent survival of VA-S and VA-R_CAZ vs concentration of CAZ. Overnight VA-S and VA-R_CAZ were incubated with CAZ (0, 1.5, 3.1, 6.25, 12.5, and 25 μg/mL) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. (C) Growth curve of VA-S and VA-R_CAZ. Overnight VA-S and VA-R_CAZ were diluted to 1:100 using fresh 3% NaCl LB medium and grown in the indicated periods. OD₆₀₀ of the bacterial cultures was measured at the indicated time. (D) Growth ability of VA-S and VA-R_CAZ in the presence of different carbon sources. Overnight VA-S and VA-R_CAZ were diluted to 1:100 using fresh 3% NaCl LB medium and grown with glucose, xylitol, fructose, sucrose, mannose, or maltose at 30°C for 10 hours. OD₆₀₀ of the bacterial cultures was measured. Results (B–D) are displayed as mean ± SEM, and significant differences are identified as determined by Student’s t-test. *P<0.05, **P<0.01. At least three biologic repeats were carried out.

Abbreviations: CAZ, ceftazidime; LB, Luria–Bertani; VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 2 Metabolic profiles of VA-S and VA-R_CAZ.

Notes: (A) Abundance of metabolites quantified in samples over two technical replicates is shown. Pearson correlation coefficient between technical replicates varies between 0.997 and 1.0. (B) Percentage of metabolites in every category. (C) Heat map of differential abundance of metabolites (row). Yellow and blue indicate increase and decrease of the metabolites scaled to mean and SD of row metabolite level, respectively (see color scale). Four biologic replicates in each group and two technical repeats for each biologic replicate were performed, yielding a total of 16 data sets. (D) Percentage of differential abundant metabolites in every category. (E) Number of differential abundant metabolites increased and decreased in every category. (F) Z-score plots corresponding to the data in panel (A). The data from VA-R_CAZ are separately scaled to the mean and SD of VA-S. Each point represents one metabolite in one technical repeat and is colored by sample types (yellow: VA-S, blue: VA-R_CAZ).

Abbreviations: VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 3 Pathway analysis.

Notes: (A) Pathway enrichment of differential abundant metabolites. (B) Integrative analysis of differential abundant metabolites in significantly enriched pathways. Yellow and blue indicate increase and decrease of metabolites, respectively. Number shows the differential abundant metabolites.

Abbreviations: VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 4 Metabolites up- or downregulated in VA-R_CAZ..

Notes: (A) Principal component analysis of VA-S and VA-R_CAZ. Each dot represents the technologic replicate analysis of samples in the plot. (B) S-plot generates from orthogonal partial least-square discriminant analysis. Predictive component p[1] and correlation p(corr)[1] differentiate VA-S and VA-R_CAZ. Each dot represents metabolites and candidate biomarkers are highlighted in red dot. (C) Candidate biomarkers by predictive component p[1], p(corr)[1], and enriched pathways. Results (C) are displayed as mean ± SEM, and significant differences are identified as determined by Student’s t-test. **P<0.01. At least three biologic repeats were carried out.

Abbreviations: VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 5 P cycle and energy metabolism in VA-R_CAZ.

Notes: (A) Abundance of five metabolites in the P cycle. (B) Flux of the P cycle and biosynthesis of fatty acids in VA-R_CAZ compared with VA-S. (C) Activity of enzymes (PDH, CS, IDH, OGDH, SDH, MDH, and ICL) in the P cycle. Overnight VA-S and VA-R_CAZ were diluted to 1:100 using fresh 3% NaCl LB medium and grown at 30°C for 3 hours. (D) Interactive Pathways Explorer (iPath) analysis. Metabolic network pathways in VA-R_CAZ were analyzed with iPath 2.0 (http://pathways2.embl.de/iPath2.cgi#). Analyses of the 42 differential metabolites (the other metabolites are not recognized in the metabolic network pathways). Red: increase; blue: decrease. (E) Percent survival of VA-S in the presence or absence of inhibitors (furfural and malonate). Overnight VA-S were incubated with CAZ (5 μg/mL) plus furfural (5, 20, and 80 μM) or malonate (5, 10, and 20 mM) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. (F) Enzyme activity of PDH and SDH in the presence or absence of inhibitors (furfural and malonate). Overnight VA-S were incubated with furfural (80 μM) or malonate (20 mM) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. Results (A, C, E, and F) are displayed as mean ± SEM, and significant differences are identified as determined by Student’s t-test. *P<0.05, **P<0.01. At least three biologic repeats were carried out.

Abbreviations: CAZ, ceftazidime; ICL, isocitrate lyase; IDH, isocitrate dehydrogenase; MDH, malate dehydrogenase; P cycle, pyruvate cycle; PDH, pyruvate dehydrogenase; SDH, succinate dehydrogenase; TCA, tricarboxylic acid; VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 6 Nqr complex and PMF.

Notes: (A) Membrane potential of VA-S and VA-R_CAZ. Overnight VA-S and VA-R_CAZ were diluted to 1:100 using fresh 3% NaCl LB medium and grown at 30°C for 3 hours, and then 10⁶ CFU/mL cells were stained with 30 μM DiOC₂(3) at 30°C for 30 minutes prior to flow cytometry assay. (B) Percent survival of VA-S in the presence of the indicated GEN. Overnight VA-S and VA-R_CAZ were incubated with gentamicin (6.25, 12.5 μg/mL) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. (C) Membrane potential of ATCC33787, nqrA-deleted, and nqrF-deleted mutants. Overnight ATCC33787, ΔnqrA, and ΔnqrF were diluted to 1:100 using fresh 3% NaCl LB medium and grown at 30°C for 3 hours, and then 10⁶ CFU/mL cells were stained with 30 μM DiOC₂(3) at 30°C for 30 minutes prior to flow cytometry analysis. (D) Percent survival of ATCC33787, nqrA-deleted, and nqrF-deleted mutants in the presence of the indicated CAZ. Overnight ATCC33787, ΔnqrA, and ΔnqrF were incubated with CAZ (0, 15, 20 μg/mL) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. (E) Percent survival of VA-S in the presence of CAZ with the indicated NaN₃ or CCCP. Overnight VA-S were incubated with CAZ (5 μg/mL) plus NaN₃ (0.08, 0.4, and 2 mM) or CCCP (1.25, 2.5, and 5 μM) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. Results are displayed as mean ± SEM, and significant differences are identified as determined by Student’s t-test. *P<0.05, **P<0.01. At least three biologic repeats were carried out.

Abbreviations: CAZ, ceftazidime; CFU, colony-forming unit; GEN, gentamicin; LB, Luria–Bertani; PMF, proton motive force; VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus; WT, wild type.

Figure 7 Fatty acid metabolism and resistance to CAZ.

Notes: (A) Percent survival of VA-R_CAZ in the presence of the indicated triclosan plus CAZ. Overnight VA-R_CAZ were incubated with CAZ (1.5 μg/mL) plus triclosan (2.5, 5 μg/mL) in M9 minimal medium plus NaAc (10 mM) at 30°C for 6 hours. (B) Percent survival of VA-S incubated in LB medium with exogenous palmitate or stearate, and then in M9 medium with CAZ (1.5 μg/mL). Overnight VA-S, cultured in LB with 0.2 mM of palmitate or stearate, were incubated with CAZ (1.25 μg/mL) in M9 minimal medium plus NaAc (10 mM) for 6 hours. (C) Quantitative real-time PCR for expression of genes in fatty acid metabolism. Overnight VA-S and VA-R_CAZ were diluted to 1:100 using fresh 3% NaCl LB medium and grown at 30°C for 3 hours. (D) Outline for expression of genes in fatty acid metabolism pathway. Red: increase, green: decrease. Results (A–C) are displayed as mean ± SEM, and significant differences are identified as determined by Student’s t-test. *P<0.05, **P<0.01. At least three biologic repeats were carried out.

Abbreviations: CAZ, ceftazidime; LB, Luria–Bertani; VA-R_CAZ, ceftazidime-resistant Vibrio alginolyticus; VA-S, ceftazidime-sensitive Vibrio alginolyticus.

Figure 8 Model for resistance to ceftazidime in Vibrio alginolyticus.

Abbreviations: NADH, nicotinamide adenine dinucleotide; P cycle, pyruvate cycle.