Evaluation of efflux pump activity of multidrug-resistant Salmonella Typhimurium isolated from poultry wet markets in India

Figures & data

Table 1 Details of primers used in this study

Name of the primer	Sequence (5ʹ–3ʹ)	Amplicon size	Reference
typh F	TTGTTCACTTTTTACCCCTGAA	401 bp	^Citation11
typh R	CCCTGACAGCCGTTAGATATT
invA F	GTGAAATTATCGCCACGTTCGGGCAA	284 bp	^Citation10
invA R	TCATCGCACCGTCAAAGGAACC

Figure 1 Antibiogram of Salmonella Typhimurium isolates from environmental sources of poultry wet markets. The concentrations of antibiotics used as per clinical and laboratory standards institution (CLSI) standards.

Abbreviations: AMP, ampicillin; AMC, amoxyclav; OX, oxacillin; CB, carbenicillin; PI, piperacillin; CZ, cefazolin; FAM, cefamandole; CF, cefaclor; CX, cefoxitin; CTX, cefotaxime; CTR, ceftriaxone; CAZ, ceftazidime; CPM, cefepime; CAC, ceftazidime/clavulanic acid; AK, Amikacin; GEN, gentamycin; K, kanamycin; CL, colistin; PB, polymyxin B; AZM, azithromycin; E, erythromycin; IPM, imipenem; MRP, meropenem; ETP, ertapenem; C, chloramphenicol; S, streptomycin; SF, sulfisoxazole; TE, tetracycline; NA, nalidixic acid and AT, aztreonam.

Figure 2 PCR detection of Salmonella Typhimurium from field samples. (A) Genus-specific invA PCR for Salmonella produced an amplicon of 284 bp, (B) Typhimurium-specific PCR produced an amplicon of 401 bp. Lane M: 100 bp molecular weight marker; Lane 1–4: Salmonella Typhimurium isolates from field samples, Lane 5: Positive control.

Figure 3 Determination of efflux pump activity by ethidium bromide (EtBr) cartwheel method. Different concentrations of EtBr were added to agar media and a loopful of fresh culture was inoculated. The plates were incubated at 37°C for overnight. The plates were visualized in UV illuminator and documented.

Table 2 Evaluation of efflux activity by EtBr cartwheel test and PAβN on antibiotic resistance profile of Salmonella Typhimurium isolates. The difference in ZOI was measured by subtracting ZOI of resistant antibiotics for each isolate in the absence of PAβN from the ZOI in the presence of PAβN

	Difference in zone of inhibition (Abp - Ab0) (mm)
Efflux activity by EtBr cart wheel test	Positive	Negative	Positive	Negative	Positive	Positive	Positive	Negative	Positive
Resistant antibiotic	ST-21	ST-75	ST-30	ST-29	ST-6A	ST-23	ST-91	ST-24	ST-11C
AMP	0	0	0	0	*	0	*	0	*
AMC	0.66	*	0	0.66	*	1	*	0.66	*
OX	0	0	0	0	0	0	0	0	0
CB	0	0	0	0	*	0	*	*	*
PI	0	0	0	0	3	0	*	*	*
CZ	2.66	*	1.66	0	*	0.66	*	*	5
FAM	11.33	*	11.66	3	*	0	*	*	*
CF	12.66	*	10	0	*	14	*	0	*
CTX	*	1	*	*	*	*	*	*	*
CTR	*	0	*	*	*	*	*	*	*
CAZ	0	0	*	*	*	*	*	*	*
CPM	*	0	*	*	*	*	*	*	*
CAC	*	0	*	*	*	*	*	*	*
K	*	*	*	*	*	*	*	3	*
CL	*	0	*	*	*	*	*	*	*
PB	*	2	5	*	*	*	*	*	*
E	0	0	0	0	0	0	0	0	0
IPM	0	*	2.66	0.66	*	0	*	6	*
SF	*	0	*	*	*	*	*	*	*
TE	0	*	0	0	*	0	*	0	*
NA	0	*	0	0	*	0	*	0	*

Notes: *Indicates the isolate is sensitive to antibiotic. The significant change in the ZOI is indicated in bold. Ab_p indicates antibiotic in the presence of PAβN; Ab₀ indicates antibiotic in the absence of PAβN.

Abbreviations: AMP, ampicillin; AMC, amoxyclav; OX, oxacillin; CB, carbenicillin; PI, piperacillin; CZ, cefazolin; FAM, cefamandole; CF, cefaclor; CX, cefoxitin; CTX, cefotaxime; CTR, ceftriaxone; CAZ, ceftazidime; CPM, cefepime; CAC, ceftazidime/clavulanic acid; AK, Amikacin; GEN, gentamycin; K, kanamycin; CL, colistin; PB, polymyxin B; AZM, azithromycin; E, erythromycin; IPM, imipenem; MRP, meropenem; ETP, ertapenem; C, chloramphenicol; S, streptomycin; SF, sulfisoxazole; TE, tetracycline; NA, nalidixic acid; AT, aztreonam; ZOI, zone of inhibition.

Alvarez J, Sota M, Vivanco A, et al. Development of a multiplex PCR technique for detection and epidemiological typing of Salmonella in human clinical samples. J Clin Microbiol. 2004;42:1734–1738. doi:10.1128/JCM.42.4.1734-1738.200415071035

 PubMed Web of Science ®Google Scholar

Galan JE, Ginocchio C, Costeas P. Molecular and functional characterization of the Salmonella invasion gene invA: homology of invA to members of a new protein family. J Bacteriol. 1992;174:4338–4349.1624429

 PubMed Web of Science ®Google Scholar