Plasmid-mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China

Figures & data

Table 1 Characteristics of mcr-1-producing Escherichia coli GB110, Klebsiella pneumoniae GB015 and their transconjugants isolated from market retail fruits in China

Isolate code	Source	Isolation site	MLST	Plasmid replicon type	Encoding genes of resistance	MICs
E. coli GB110	Apple	Market retail fruits	ST189	IncHI1,IncFIA	aadA2, aadA1, mcr-1, floR, cmlA1, sul2, sul3, tetA, tetM, dfrA12, mdfA	CL (16), PB (8), TGC (≤1), AMP (4), AMC (8), CTX (≤0.125), CAZ (≤0.125), FEP (0.25), GEN (≤1), AMK (4), ETP (≤0.125), IPM (≤0.125), MEM (≤0.125), FOS (≤8), NIT (≤8), CIP (≤0.03)
K. pneumoniae	Orange	Market	ST442	IncHI1,	bla, mcr-1, SHV-110	CL (64), PB (64), TGC (≤1), AMP (64), AMC (8),
GB015		retail fruits		IncFIB	qnrS1, oqxA, oqxB, fosA6, sul1, tetA, dfrA1	CTX (≤0.125), CAZ (0.5), FEP (≤0.125), GEN (≤1), AMK (4), ETP (≤0.125), IPM (0.5), MEM (≤0.125), FOS (16), NIT (64), CIP (1)
E. coli C600 (transconjugant of E. coli GB110)	–	–	–	IncFIA	mcr-1	CL (16), PB (8), TGC (≤1), AMP (4), AMC (8), CTX (≤0.125), CAZ (≤0.125), FEP (≤0.125), GEN (≤1), AMK (4), ETP (≤0.125), IPM (≤0.125), MEM (≤0.125), FOS (≤8), NIT (8), CIP (≤0.03)
E. coli C600 (transconjugant of K. pneumoniae GB015)	–	–	–	IncHI1	mcr-1	CL (16), PB (16), TGC (≤1), AMP (4), AMC (8), CTX (≤0.125), CAZ (≤0.125), FEP (≤0.125), GEN (≤1), AMK (4), ETP (≤0.125), IPM (≤0.125), MEM (≤0.125), FOS (≤8), NIT (≤8), CIP (≤0.03)

Abbreviations: AMC, amoxicillin–clavulanic acid; AMK, amikacin; AMP, ampicillin; CAZ, ceftazidime; CIP, ciprofloxacin; CL, colistin; CTX, cefotaxime; ETP, ertapenem; FEP, cefepime; FOS, fosfomycin; GEN, gentamicin; IPM, imipenem; MEM, meropenem; MIC, minimum inhibitory concentration; MLST, multilocus sequence typing; NIT, nitrofurantoin; PB, polymyxin B; TGC, tigecycline.

Figure 1 S1-PFGE and Southern hybridization with the mcr-1 probe.

Abbreviations: E. coli, Escherichia coli; K. pneumoniae, Klebsiella pneumoniae; S1-PFGE, pulsed field gel electrophoresis analysis of S1 nuclease-digested DNA.

Table S1 Primers and PCR conditions used in this study

Purpose	Primer	Nucleotide sequence (5′→3′)	Amplicon size (bp)	Annealing temperature (°C)
Amplification of mcr-1	MCR-1F	ATCAGCCAAACCTATCCCATCG	1,257	55
	MCR-1R	GCAGACGCACAGCAATGCCTAT
Amplification of mcr-2	MCR-2F	GCGATGGCGGTCTATCCTGTAT	378	55
	MCR-2R	TGCGATGACATGGGGTGTCAGC
Amplification of mcr-3	MCR-3F	TATGGGTTACTATTGCTGG	814	55
	MCR-3R	CTACCCTGATGCTCATCG
Amplification of mcr-4	MCR-4F	GTCATAGTGGTATAAAAGTACAG	669	55
	MCR-4R	CCACCGTCTATCAGAGCCAAC
Amplification of mcr-5	MCR-5F	GCGGTTGTCTGCATTTATCAC	1,042	50
	MCR-5R	CTTTGAAAACCTGTCTTCGGCA
Amplification of mcr-6	MCR-6F	GTCCGGTCAATCCCTATCTGT	556	55
	MCR-6R	ATCACGGGATTGACATAGCTAC
Amplification of mcr-7	MCR-7F	TGCTCAAGCCCTTCTTTTCGT	892	55
	MCR-7R	TTCATCTGCGCCACCTCGT
Amplification of mcr-8	MCR-8F	AACCGCCAGAGCACAGAATT	667	60
	MCR-8R	TTCCCCCAGCGATTCTCCAT