Genotype Analysis of Clinical Candida albicans Isolates Using PCRs Targeting 25S rDNA and ALT Repeat Sequences of the RPS and Antifungal Susceptibility in Ouagadougou (Burkina Faso)

Figures & data

Table 1 List of PCR Primers (25SrDNA and RPS) and Expected Sizes of PCR Products

Primers	Nucleotide Sequences	Band Size (pb)	25SrDNA Type
		450	A
CA-INT-L	ATAAGGGAAGTCGGCAAAATAGATCCGTAA	840	B
CA-INT-R	CCTTGGCTGTGGTTTCGCTAGATAGTAGAT	450 & 840	C
		1040	D
		1080	E
Primers	Nucleotide sequences	Band size (pb)	RPS TYPE
		526	1
		698	2
ASDcF	TGATGAACCACATGTGCTACAAAG	870	3
Pcscr	CGCCTCTATTGGTCGAGCAGTAGTC	1042	4
		1214	5
		1396	6

Table 2 Frequency and Distribution of Candida albicans Genotypes According to Sources of Isolation

Clinical Origin	Genotypes
	A	B	C
	n (%)	n (%)	n (%)
Oral (n=59)	45 (76.3)	10 (16.9)	4 (6.8)
Vulvovaginal (n=17)	17 (100.0)	0 (0.0)	0 (0.0)
Nail (n=8)	8 (100.0)	0 (0.0)	0 (0.0)
Digestive (n=5)	5 (100.0)	0 (0.0)	0 (0.0)
Pulmonary (n=3)	3 (100.0)	0 (0.0)	0 (0.0)
Cutaneous (n=3)	3 (100.0)	0 (0 .0)	0 (0.0)
Bladder (n=1)	1 (100.0)	0 (0.0)	0 (0.0)
All origins (96)	82 (85.4)	10 (10.4)	4 (4.2)

Notes: n = number. % = percentage. Among the 96 isolates, 82 were classified as genotype A (85.4%), 10 genotype B (10.4%) and 4 genotype C (4.2%).

Figure 1 Amplification profiles of PCR products (25S rDNA) of Candida albicans isolates.

Figure 2 Variations in Candida albicans RPS types based on PCR amplification profiles using RPS primers.

Table 3 Analysis of Candida albicans RPS Types by RPS Primers

Genotype A RPS Types				Genotype B Type				Genotype C RPS Type		Total
A2	A3	A2/3	A3/4	B2	B3	B2/3	B3/4	C2	C2/3	RPS types
23	39	14	6	2	2	5	1	3	1	96
24.0%	40.6%	14.6%	6.3%	2.1%	2.1%	5.2%	1.0%	3.2%	1.0%	100%

Notes: Genotyping of RPS-based isolates was determined based on the repeated numbers of the ALT sequence in the main product that had the highest intensity. C. albicans genotypes A, B and C were classified into 10 RPS types of genotypes.

Table 4 Azoles and Polyenes Susceptibility Profiles of Candida albicans Genotypes and RPS Types

Genotypes		FLU			ITRA			MIC			ECO			CLO			KET			NYS			AMB
		S	SDD	R	S	SDD	R	S	SDD	R	S	SDD	R	S	SDD	R	S	SDD	R	S	SDD	R	S	SDD	R
		n (%)	n(%)	n(%)	n(%)	n (%)	n (%)	n (%)	n (%)	n (%)	n(%)	n(%)	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)	n (%)	n(%)	n (%)	n (%)	n (%)	n (%)	n (%)
A (n=82)	A2	5(6.1)	3(3.7)	15(18,3)	4(4.9)	2(2.4)	17(20.8)	8(9.7)	15(18,3)	0(0.0)	18(22.0)	5(6.1)	0(0.0)	23(28.0)	0(0.0)	0(0.0)	7(8.5)	10(12.2)	6(7.3)	21(25.6)	2(2.4)	0(0.0)	14(17.1)	3(3.7)	6(7.3)
	A3	6(7.3)	3(3.7)	30(36,6)	6(7.3)	8(9.7)	25(30.5)	16(19.5)	22(26,8)	1(1.2)	25(30.5)	14(17.1)	0(0.0)	37(45.1)	0(0.0)	2(2.4)	15(18.3)	14(17.1)	10(12.2)	0(0.0)	38(46.4)	1(1.2)	26(31.7)	4(4.9)	9(11.0)
	A2/3	0(0.0)	2(2.4)	12(14,6)	1(1.2)	3(3.7)	10(12.2)	5(6.1)	9(11,0)	0(0.0)	12(14.6)	2(2.4)	0(0.0)	14(17.1)	0(0.0)	0(0.0)	5(6.1)	5(6.1)	4(4.9)	0(0.0)	14(17.1)	0(0.0)	5(6.1)	2(2.4)	7(8.5)
	A3/4	1(1.2)	1(1.2)	4(4,9)	2(2.4)	0(0.0)	4(4.9)	4(4.9)	1(1,2)	1(1.2)	4(4.9)	2(2.4)	0(0.0)	6(7.3)	0(0.0)	0(0.0)	4(4.9)	1(1.2)	1(1.2)	0(0.0)	6(7.3)	0(0.0)	3(3.6)	1(1.2)	2(2.5)
	Total	12 (14.6)	9 (11.0)	61(74.4)	13 (15.8)	13 (15.8)	56 (68.4)	33 (40.2)	47 (57.3)	2 (2.5)	59 (72.0)	23 (28.0)	0 (0.0)	80 (97.5)	0 (0.0)	2 (2,4)	31 (37.8)	30 (36.6)	21 (25.6)	21(25.6)	60(73.2)	1(1.2)	48(58.5)	10(12.2)	24(29.3)
B (n=10)	B2	1(10.0)	1(10.0)	0(0.0)	1(10.0)	0(0.0)	1(10.0)	0(0.0)	2(20,0)	0(0.0)	1(10.0)	1(10.0)	0(0.0)	2(20.0)	0(0.0)	0(0.0)	0(0.0)	1(10.0)	1(10.0)	2(20.0)	0(0.0)	0(0.0)	1(10.0)	0(0.0)	1(10.0)
	B3	0(0.0)	0(0.0)	2(20.0)	1(10.0)	0(0.0)	1(10.0)	1(10.0)	1(10,0)	0(0.0)	2(20.0)	0(0.0)	0(0.0)	2(20.0)	0(0.0)	0(0.0)	1(10.0)	00(0.0)	1(10.0)	2(20.0)	0(0.0)	0(0.0)	0(0.0)	1(10.0)	1(10.0)
	B2/3	1(10.0)	1(10.0)	3(30.0)	0(0.0)	1(10.0)	4(40.0)	1(10.0)	4(40,0)	0(0.0)	4(40.0)	1(10.0)	0(0.0)	5(50.0)	0(0.0)	0(0.0)	1(10.0)	4(40.0)	0(0.0)	5(50.0)	0(0.0)	0(0.0)	4(40.0)	0(0.0)	1(10.0)
	B3/4	0(0.0)	1(10.0)	0(0.0)	0(0.0)	0(0.0)	1(10.0)	1(10.0)	0(0,0)	0(0.0)	0(0.0)	1(10.0)	0(0.0)	1(10.0)	0(0.0)	0(0.0)	0(0.0)	1(10.0)	0(0.0)	1(10.0)	0(0.0)	0(0.0)	1(10.0)	0(0.0)	0(0.0)
	Total	2 (20.0)	3 (30.0)	5 (50.0)	2 (20.0)	1 (10.0)	7 (70.0)	3 (30.0)	7 (70.0)	0 (0.0)	7 (70.0)	3 (30.0)	0 (0.0)	10 (100)	0 (0.0)	0 (0.0)	2 (20.0)	6 (60.0)	2 (20.0)	10(100.0)	0(0.0)	0(0.0)	6(60.0)	1(10.0)	3(30.0)
C (n=4)	C2	0(0.0)	1(25.0)	2(50.0)	0 (0.0)	0 (0.0)	3(75.0)	1(25.0)	2(50,0)	0 (0.0)	2(50.0)	1(25.0)	0 (0.0)	3(75.0)	0 (0.0)	0 (0.0)	1(25.0)	2(50.0)	0 (0.0)	3(75.0)	0 (0.0)	0 (0.0)	3(75.0)	0 (0.0)	0 (0.0)
	C2/3	0(0.0)	1(25.0)	0 (0.0)	0 (0.0)	0 (0.0)	1(25.0)	00 (0.0)	1(25,0)	0 (0.0)	2 1(25.0)	0 (0.0)	0 (0.0)	1(25.0)	0 (0.0)	0 (0.0)	00 (0.0)	0 (0.0)	1(25.0)	1(25.0)	0 (0.0)	0 (0.0)	1(25.0)	0 (0.0)	0 (0.0)
	Total	0 (0.0)	2 (50.0)	2 (50.0)	0 (0.0)	0 (0.0)	4 (100)	1 (25.0)	3 (75.0)	0 (0.0)	3 3(75.0)	1 (25.0)	0 (0.0)	4 (100)	0 (0.0)	0 (0.0)	1 (25.0)	2 (50.0)	1 (25.0)	4(100)	0(0,0)	0 (0.0)	4(100)	0 (0.0)	0 (0.0)

Notes: Azole resistance is present with all three genotypes. It is more common with genotype A, including A3, A2 and A2/3 RPS types. Resistance to amphotericin B was observed with strains of genotypes A (29.3%) and B (30%) with respectively their RPS types A3, A2/3 and B2, B3, B2/3. Nystatin resistance is absent with genotypes B and C. It was rare with genotype A (single strain, A3: 1.2%). Percentages of resistant RPS types are calculated taking into account the total number of each genotype, and according to antifungal drug tested. For example, strain A3 36.6% of genotype A was resistant to fluconazole was calculated as follows: 30/82 x100 = 36.6%. 30 = number of Fluconazole RPS type A3 resistant, 82 = total number of genotype A strains. The bold values indicate the total numbers of sensisitive (s), dose-dependant sensitive (SDD) and resistant strains for each of the A,B and C genotypes based on antifungal drugs.