Association Between Biofilm Formation, Structure, and the Expression Levels of Genes Related to biofilm formation and Biofilm-Specific Resistance of Acinetobacter baumannii Strains Isolated from Burn Infection in Ahvaz, Iran

Figures & data

Table 1 Primers Used in This Study

Target	Primers	Length (bp)	Ref.
blaOXA-51	F:TAATGCTTTGATCGGCCTTG R: TGGATTGCACTTCATCTTGG	353	^Citation17
pgaA	F: GCCGACGGTCGCGATAC R: ATGCACATCACCAAAACGGTACT	150	^Citation24
csuE	F: TCAGACCGGAGAAAAACTTAACG R: GCCGGAAGCCGTAT GTAGAA	150	^Citation24
bap	F: AATGCACCGGTACTTGATCC R: TATTGC CTGCAGGGTCAGTT	205	^Citation24
ompA	F: ATGAAAAAGACAGCTATCGCGATTGCA R: CACCAAAAGCACCAGCGCCCAGTTG	136	^Citation15
abaI	F: AATGCCTATTCCCTGCTCAC R: ATTGCTTCTTGCAGAATTGC	132	^Citation15
16 S rRNA	F: ACTCCTACGGGAGGCAGCAGT R: TATTACCG CGGCTGCTGGC	198	^Citation9

Table 2 MICs of Tested Antibiotics and ERIC-PCR Types for Acinetobacter baumannii Strains

Type	Strain No.	AK	CFP	LVF	TIG	MEM	COL	Type	Strain No.	AK	CFP	LVF	TIG	MEM	COL
		(µg/mL)								(µg/mL)
CT01	AB11	64	128	8	16	64	1	CT08	AB56	16.0	4	4	0.5	2	0.5
CT01	AB01	64	128	8	16	64	0.5	CT09	AB38	128	512	128	8	8	0.25
CT01	AB02	128	128	8	16	128	0.25	CT09	AB35	128	256	128	4	8	0.25
CT02	AB19	128	64	1	2	1	1	CT09	AB36	64	256	128	8	8	1
CT02	AB20	128	128	1	2	1	1	CT10	AB37	128	8	8	2	256	1
CT02	AB62	128	64	2	2	1	0.5	CT10	AB34	128	16	8	1	256	0.25
CT03	AB03	256	512	16	8	256	1	CT10	AB39	128	16	8	4	128	0.25
CT03	AB04	256	512	16	8	512	0.5	CT10	AB40	64	8	4	1	128	1
CT03	AB42	256	256	16	4	512	0.5	CT10	AB10	64	16	4	4	128	1
CT03	AB41	256	512	32	4	512	0.25	CT10	AB09	128	16	4	2	256	0.5
CT03	AB08	256	512	16	8	256	0.25	CT11	AB43	128	128	64	16	512	0.5
ST01	AB15	16	16	32	4	512	1	CT11	AB44	128	128	64	4	512	0.5
CT04	AB64	16	4	2	0.5	2	0.5	CT11	AB45	256	128	64	8	1024	0.25
CT04	AB12	16	4	2	0.5	2	0.5	CT11	AB47	256	128	32	4	256	0.25
ST02	AB16	512	512	4	4	64	0.5	CT11	AB46	512	128	32	4	512	1
ST03	AB18	512	256	4	4	256	1	CT11	AB32	512	128	64	16	512	1
CT05	AB17	512	512	64	16	512	0.5	CT11	AB49	256	256	64	16	512	1
CT05	AB05	256	512	64	32	256	1	CT11	AB31	512	128	32	16	1024	0.25
CT05	AB06	512	256	64	16	256	0.5	ST07	AB51	64	512	64	0.5	64	0.25
ST04	AB07	64	512	128	4	512	0.25	ST08	AB52	16	2	512	1	64	0.5
CT06	AB21	8	4	1	4	4	0.25	CT12	AB54	512	1	4	4	64	0.5
CT06	AB22	8	4	1	4	4	0.5	CT12	AB53	512	0.5	4	4	128	0.25
ST05	AB28	256	16	4	1	512	0.5	CT13	AB50	64	1	128	1	2	0.25
CT07	AB24	512	128	64	4	256	0.25	CT13	AB33	64	2	128	0.5	2	0.25
CT07	AB25	512	128	64	4	128	0.25	ST09	AB57	16	1	64	0.5	1	0.5
CT07	AB26	512	256	128	4	128	1	ST10	AB58	256	16	4	0.5	256	1
ST06	AB23	256	16	4	4	128	0.25	ST11	AB59	512	8.	4	0.5	512	1
CT08	AB27	16	8	2	0.5	2	0.5	CT14	AB60	128	512	64	2	64	0.5
CT08	AB29	16	4	2	0.25	2	0.25	CT14	AB61	256	512	128	2	128	0.5
CT08	AB30	16	8	4	4	1	0.5	CT14	AB13	128	256	128	2	128	0.5
CT08	AB55	32	8	4	4	2	1	CT14	AB63	128	256	128	2	128	0.5
CT08	AB48	32	4	2	0.5	1	0.25	CT14	AB14	256	256	64	1	128	0.25

Abbreviations: CT, clonal type; ST, single type; AK, amikacin; LVF, levofloxacin; CEF, cefepime; TIG, tigecycline; COL, colistin; MEM, meropenem.

Figure 1 Dendrogram of ERIC-PCR analysis of 64 Acinetobacter baumannii strains.

Table 3 Biofilm-Forming Capacity (OD_570), Composition of the biofilm Matrix and ERIC-PCR Type of Acinetobacter baumannii Strains

Type	Strain	Capacity of Biofilm Formation	Removed Biofilm			Type	Strain	Capacity of Biofilm Formation	Removed Biofilm
			NaIO4	PK	DNAseI				NaIO4	PK	DNAseI
CT01	AB11	Weak	++	+	+	CT08	AB56	Strong	+++	+	−
CT01	AB01	Weak	++	+	+	CT09	AB38	Weak	++	−	++
CT01	AB02	Weak	++	+	+	CT09	AB35	Weak	++	−	++
CT02	AB19	Strong	+++	+	–	CT09	AB36	Weak	++	−	++
CT02	AB20	Strong	+++	+	–	CT10	AB37	Intermediate	+++	+	−
CT02	AB62	Strong	+++	+	–	CT10	AB34	Intermediate	+++	+	−
CT03	AB03	Weak	+++	–	–	CT10	AB39	Intermediate	+++	+	−
CT03	AB04	Weak	+++	–	–	CT10	AB40	Intermediate	+++	+	−
CT03	AB42	Weak	+++	–	–	CT10	AB10	Intermediate	+++	+	−
CT03	AB41	Weak	+++	–	–	CT10	AB09	Intermediate	+++	+	−
CT03	AB08	Weak	+++	–	–	CT11	AB43	Weak	++	+	+
ST01	AB15	None	–	–	–	CT11	AB44	Weak	++	+	+
CT04	AB64	Strong	++	+	+	CT11	AB45	Weak	++	+	+
CT04	AB12	Strong	++	+	+	CT11	AB47	Weak	++	+	+
ST02	AB16	None	–	–	–	CT11	AB46	Weak	++	+	+
ST03	AB18	None	–	–	–	CT11	AB32	Weak	++	+	+
CT05	AB17	Weak	+++	+	–	CT11	AB49	Weak	++	+	+
CT05	AB05	Weak	+++	+	–	CT11	AB31	Weak	++	+	+
CT05	AB06	Weak	+++	+	–	ST07	AB51	Weak	+++	–	+
ST04	AB07	Weak	+++	–	+	ST08	AB52	Strong	++	+	+
CT06	AB21	Strong	++	++	–	CT12	AB54	None	–	–	–
CT06	AB22	Strong	++	++	–	CT12	AB53	None	–	–	–
ST05	AB28	None	–	–	–	CT13	AB50	Intermediate	++	++	–
CT07	AB24	Weak	++	++	–	CT13	AB33	Intermediate	++	++	–
CT07	AB25	Weak	++	++	–	ST09	AB57	Strong	+	++	+
CT07	AB26	Weak	++	++	–	ST10	AB58	None	–	–	–
ST06	AB23	None	–	–	–	ST11	AB59	None	–	–	–
CT08	AB27	Strong	+++	+	–	CT14	AB60	Intermediate	+++	–	+
CT08	AB29	Strong	+++	+	–	CT14	AB61	Intermediate	+++	–	+
CT08	AB30	Strong	+++	+	–	CT14	AB13	Intermediate	+++	–	+
CT08	AB55	Strong	+++	+	–	CT14	AB63	Intermediate	+++	–	+
CT08	AB48	Strong	+++	+	–	CT14	AB14	Intermediate	+++	–	+

Abbreviations: CT, clonal type; ST, single type; NaIO4, sodium metaperiodate; PK, proteinase K; + = ≤30%; ++ = 30–70% and +++ = ≥70%.

Table 4 Association Between the Biofilm-Forming Capacities and Antibiotic Resistance

Antibiotic Agents	Optical Density 570			rs	P value
	Susceptible Moderate Resistance
Amikacin	0.950(0.917–0.984)	0.687(0.051–0.974)	0.206(0.047–0.864)	−0.708	<0.001
Meropenem	0.748(0.741–0.755)	0.728 (0.051–0.984)	0.181(0.047–0.302)	−0.664	<0.001
Levofloxacin	0.809(0.630–0.954)	0.298(0.047–0.984)	0.192(0.051–0.874)	−0.258	<0.001
Tigecycline	0.458(0.047–0.954)	0.265(0.054–0.284)	0.141(0.114–0.164)	−0.479	<0.001
Cefepime	0.563(0.051–0.984)	0.219(0.054–0.864)	0.166 (0.047–0.287)	−0.406	0.001
Colistin	0.312(0.047–0.984)	–	–	−0.030	0.813

Table 5 Association Between the Biofilm Formation Capacity, the Clonal Types and Gene Profiles

Capacity of Biofilm Formation	Gene Profile	ERIC-PCR Type	Frequency (%)
Strong	Bap, CsuE, OmpA, pgaA, abaI	CT02, CT04, CT06 CT08,ST08, ST09	15 (23.43)
Moderate	CsuE,OmpA, pgaA, abaI	CT14,CT10	3 (4.6)
	Bap, OmpA, pgaA, abaI	CT14	2 (3.1)
	Bap, CsuE, OmpA, pgaA, abaI	CT13, CT14, CT10	8 (12.5)
Weak	OmpA, pgaA, abaI	CT01, CT03, CT11,ST04, ST07	18 (28.12)
	CsuE, OmpA, pgaA, abaI	CT05	3 (4.6)
	Bap,OmpA, pgaA, abaI	CT07, CT09	6 (9.37)
None	OmpA, abaI	ST01,ST02, ST05,ST10	4 (6.25)
	CsuE,OmpA, abaI	CT12,ST11, ST06,ST03	5 (7.8)

Table 6 Association Between the Expression Levels of Genes Involved in Biofilm Formation and the biofilm formation Capacity

Capacity of Biofilm Formation	bap	ompA	pgaA	abaI	csuE
Weak	0.65(0.54–0.75)	0.60(0.41–0.95)	0.71(0.54–0.91)	0.71 (0.62–0.85)	2.58(1.65–3.65)
Intermediate	1.91(1.43–2.41)	1.02(0.84–1.56)	1.18(0.82–1.95)	1.29(0.84–1.64)	0.72(0.54–0.95)
Strong	4.73 (2.65–6.31)	3.87(2.11–5.32)	3.87(2.65–4.62)	4.03(2.23–7.14)	4.41(2.92–7.45)
No biofilm	0	0.59(0.41–0.84)	0	0.50(0.45–0.63)	1.97(1.52–2.23)
P value	<0.01	<0.01	<0.01	<0.01	<0.01

Table 7 Expression Levels of mRNA of the adeB, adeJ and adeG Genes with Regard to Non-Susceptible to Antibiotics

Antibiotic	Group	MIC (µg/mL)	Gene Expression of
			adeB	adeJ	adeG
Cefepime	Susceptible (n=19)	≤8	<1; n=3	<1; n=8	<1; n=9
			1.31–9.47; n=10	1.37–1.85; n=11	1.39–4.65; n=3
			10.22–85.63; n=6		10.1–69.35; n=5
	Non-susceptible (n=45)	16–128	<1; n=3	<1; n=11	<1; n=9
			1.16–6.41; n=15	1.23–1.96; n=12	1.23–8.65; n=10
			15.97–52.15; n=5		12.32–41.32; n=4
		≥256	<1; n=5	<1; n=10	<1; n=6
			1.14–8.47; n=17	1.23–1.89; n=12	1.56–8.45; n=9
					12.36–75.21; n=7
Amikacin	Susceptible (n=11)	≤16	<1; n=1	<1; n=3	<1; n=6
			1.45–9.74; n=5	1.37–1.85; n=8	2.35–4.45; n=2
			10.22–85.63; n=5		12.5–69.35; n=3
	Non-susceptible (n=53)	32–128	<1; n=5	<1; n=11	<1; n=8
			1.16–6.41; n=16	1.23–1.89; n=13	1.32–8.65; n=13
			18.64–52.15; n=3		12.59–41.32;n=3
		≥256	<1; n=5	<1; n=15	<1; n=12
			1.14–8.47; n=22	1.23–1.95; n=14	1.23–3.76; n=7
			15.97–30.41; n=2		10.1–75.21;n=10
Tigecycline	Susceptible (n=26)	≤2	<1; n=5	<1; n=7	<1; n=12
			1.14–9.47; n=16	1.23–1.89; n=19	1.32–8.65; n=10
			19.84–85.63; n=5		12.25–69.34; n=4
	Non-susceptible (n=38)	4–32	<1; n=6	<1; n=22	<1; n=14
			1.14–8.74; n=26	1.23–1.96; n=16	1.23–8.45; n=12
			10.22–37.14; n=6		10.1–75.21; n=12
Meropenem	Susceptible (n=14)	≤2	<1; n=3	<1; n=5	<1; n=8
			1.14–9.47; n=6	1.23–1.69; n=9	1.39–8.69; n=3
			34.14–85.63; n=5		12.25–69.35; n=3
	Non-susceptible (n=50)	4–64	<1; n=2	<1; n=7	<1; n=3
			1.45–6.41; n=8	1.5–1.86; n=5	1.56–4.65; n=7
			10.22–19.84; n=2		10.1–12.95; n=2
		128–1024	<1; n=6	<1; n=17	<1; n=15
			1.14–8.74; n=28	1.23–1.96; n=23	1.23–8.45; n=12
			15.97–37.14; n=4		10.65–75.21; n=11
Levofloxacin	Susceptible (n=10)	≤2	<1; n=1	<1; n=3	<1; n=3
			1.16–9.47; n=4	1.23–1.52; n=7	2.36–8.65; n=4
			10.22–85.63; n=5		12.25–69.35; n=3
	Non-susceptible (n=54)	4–32	<1; n=2	<1; n=18	<1; n=14
			1.16–6.41; n=22	1.23–1.96; n=11	1.23–4.56; n=6
			15.97–37.14; n=5		10.1–75.21; n=9
		64–512	<1; n=8	<1; n=8	<1; n=9
			1.14–8.47; n=14	1.25–1.89; n=17	1.23–8.45; n=12
			19.84; n=1		12.25–51.23; n=4

Table 8 Expression Levels of mRNA of the adeB, adeJ and adeG Genes with Regard to Capacity of Biofilm Formation

Capacity of Biofilm Formation (Number)	Gene Expression Level
	adeb	(Number)	adeJ	(Number)	adeG	(Number)
Non-biofilm (n=9)	1<;	n=1	1<;	n=4	1<;	n=5
	1.32–6.34;	n=7	1.65–1.96;	n=5	2.58–15.63;	n=4
	37.34;	n=1
Weak (n=27)	1<;	n=5	1<;	n=16	1<;	n=8
	1.32–6.34;	n=20	1.32–1.85;	n=11	1.32–8.45;	n=10
	37.34;	n=2			12.36–75.21;	n=9
Intermediate (n=13)	1<;	n=3	1<;	n=3	1<;	n=5
	1.14–2.64;	n=9	1.39–1.89;	n=10	1.32–3.78;	n=7
	18.64;	n=1			15.69;	n=1
Strong (n=15)	1<;	n=2	1<;	n=6	1<;	n=8
	1.16–9.47;	n=6	1.23–1.58;	n=9	2.36–8.45;	n=4
	10.22–85.63;	n=7			12.25–69.35;	n=3
P value	0.298		0.004		0.899

Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this species. J Clin Microbiol. 2006;44(8):2974–2976. doi:10.1128/JCM.01021-0616891520

 PubMed Web of Science ®Google Scholar

Navidifar T, Amin M, Rashno M. Effects of sub-inhibitory concentrations of meropenem and tigecycline on the expression of genes regulating pili, efflux pumps and virulence factors involved in biofilm formation by Acinetobacter baumannii. Infect Drug Resist. 2019;12:1099–1111. doi:10.2147/IDR.S19999331190904

 PubMed Web of Science ®Google Scholar

He X, Lu F, Yuan F, et al. Biofilm formation caused by clinical Acinetobacter baumannii isolates is associated with overexpression of the AdeFGH efflux pump. Antimicrob Agents Chemother. 2015;59(8):4817–4825. doi:10.1128/AAC.00877-1526033730

 PubMed Web of Science ®Google Scholar

Bhargava N, Sharma P, Capalash N. Quorum sensing in Acinetobacter: an emerging pathogen. Crit Rev Microbiol. 2010;36(4):349–360. doi:10.3109/1040841X.2010.51226920846031

 PubMed Web of Science ®Google Scholar