The Phylogenetic Relatedness of bla_NDM-1 Harboring Extended-Spectrum β-Lactamase Producing Uropathogenic Escherichia coli and Klebsiella pneumoniae in the North of Iran

Figures & data

Table 1 Primer Sequences Used in the Present Study

Primer	Oligonucleotide Sequence (5′ to 3′)	Gene	Reference
SHV-F	ATGCGTTATATTCGCCTGTG	blaSHV	^Citation13
SHV-R	TGCTTTGTTATTCGGGCCAA
NDM-F	GCAGCTTGTCGGCCATGCGGGC	blaNDM	^Citation14
NDM-R	GGTCGCGAAGCTGAGCACCGCAT
OXA-F	TTTTCTGTTGTTTGGGTTTT	blaOXA-1	^Citation15
OXA-R	TTTCTTGGCTTTTATGCTTG

Table 2 The Results of Antibiotic Susceptibility Pattern of E. coli Isolates

Antibiotic	Total No. 223			ESBLs-Positive No. 84			P value^a
	Susceptible	Intermediate	Resistant	Susceptible	Intermediate	Resistant
Ampicillin	34 (15.2)	8 (3.6)	181 (81.2)	1 (1.2)	1 (1.2)	82 (97.6)	<0.001
Amoxicillin-clavulanate	98 (43.9)	58 (26)	67 (30)	19 (22.6)	35 (41.7)	30 (35.7)	<0.001
Cefoxitin	176 (78.9)	21 (9.4)	26 (11.7)	61 (72.6)	13 (15.5)	10 (11.9)	0.073
Cefixime	99 (44.4)	16 (7.2)	108 (48.4)	1 (1.2)	0	83 (98.8)	<0.001
Ceftazidime	115 (51.6)	20 (9)	88 (39.5)	6 (7.1)	10 (11.9)	68 (81)	<0.001
Cefotaxime	111 (49.8)	9 (4.0)	103 (46.2)	3 (3.6)	1 (1.2)	80 (95.2)	<0.001
Cefepime	148 (66.4)	19 (8.5)	56 (25.1)	21 (25)	15 (17.9)	48 (57.1)	<0.001
Ciprofloxacin	114 (51.1)	13 (5.8)	96 (43)	21 (25.0)	3 (3.6)	60 (71.4)	<0.001
Ofloxacin	126 (56.5)	3 (1.3)	94 (42.2)	25 (29.8)	0	59 (70.2)	<0.001
Nalidixic acid	48 (21.5)	16 (7.2)	159 (71.3)	5 (6)	3 (3.6)	76 (90.5)	<0.001
Aztreonam	123 (55.2)	16 (7.2)	84 (37.7)	4 (4.8)	13 (15.5)	67 (79.8)	<0.001
Tetracycline	77 (34.5)	3 (1.3)	143 (64.1)	22 (26.2)	1 (1.2)	61 (72.6)	0.042
Gentamicin	191 (85.7)	7 (3.1)	25 (11.2)	63 (75)	4 (4.8)	17 (20.2)	<0.001
Trimethoprim sulfamethoxazole	85 (38.1)	0	138 (61.9)	17 (20.2)	0	67 (79.8)	<0.001
Nitrofurantoin	199 (89.2)	6 (2.7)	18 (8.1)	66 (78.6)	3 (3.6)	15 (17.9)	<0.001
Imipenem	218 (97.8)	5 (2.2)	0	82 (97.6)	2 (2.4)	0	0.91

Note: ^aCompared with antibiotic resistance pattern of non-ESBL-producing isolates.

Table 3 The Results of Antibiotic Susceptibility Pattern of K. pneumoniae Isolates

Antibiotic	Total No. 68			ESBLs-Positive No. 22			P value^a
	Susceptible	Intermediate	Resistant	Susceptible	Intermediate	Resistant
Amoxicillin-clavulanate	35 (51.5)	7 (10.3)	26 (38.2)	1 (4.5)	6 (27.3)	15 (68.2)	<0.001
Cefoxitin	55 (80.9)	2 (2.9)	11 (16.2)	16 (72.7)	2 (9.1)	4 (18.2)	0.24
Cefixime	39 (57.4)	0	29 (42.6)	0	0	22 (100)	<0.001
Ceftazidime	38 (55.9)	2 (2.9)	28 (41.2)	0	1 (4.5)	21 (95.5)	<0.001
Cefotaxime	39 (57.4)	1 (1.5)	28 (41.2)	0	0	22 (100)	<0.001
Cefepime	44 (64.7)	2 (2.9)	22 (32.4)	3 (13.6)	1 (4.5)	18 (81.8)	<0.001
Ciprofloxacin	47 (69.1)	8 (11.8)	13 (19.1)	9 (40.9)	3 (13.6)	10 (45.5)	<0.001
Ofloxacin	53 (77.9)	2 (2.9)	13 (19.1)	12 (54.5)	1 (4.5)	9 (40.9)	0.001
Nalidixic acid	20 (29.4)	26 (38.2)	22 (32.4)	4 (18.2)	6 (27.3)	12 (54.5)	0.16
Aztreonam	40 (58.8)	2 (2.9)	26 (38.2)	1 (4.5)	1 (4.5)	20 (90.9)	<0.001
Tetracycline	42 (61.8)	0	26 (38.2)	9 (40.9)	0	13 (59.1)	0.014
Gentamicin	48 (70.6)	1 (1.5)	19 (27.9)	9 (40.9)	1 (4.5)	12 (54.5)	<0.001
Trimethoprim/sulfamethoxazole	42 (61.8)	1 (1.5)	25 (36.8)	7 (31.8)	0	15 (68.2)	<0.001
Nitrofurantoin	32 (47.1)	12 (17.6)	24 (35.3)	5 (22.7)	5 (22.7)	12 (54.5)	0.005
Imipenem	64 (94.1)	1 (1.5)	3 (4.4)	19 (86.4)	1 (4.5)	2 (9.1)	0.06

Note: ^aCompared with antibiotic resistance pattern of non-ESBL-producing isolates.

Table 4 The Full Results of Investigated Genes Separated by Pathogen, MDR, ESBLs, and Carbapenem Resistance

Gene	E. coli				K. pneumoniae
	Total No. 223	ESBLs No. 84	IMI-R No. 5	MDR No. 184	Total No. 68	ESBLs No. 22	IMI-R No. 4	MDR No. 41
blaSHV	6	6^a	0	6	10	9^a	0	9^a
blaNDM	4	4^a	0	4	8	7^a	3^a	8^a
blaOXA-1	33	31^a	0	32^a	15	15^a	0	15^a

Note: ^aP value compared to susceptible isolates was statistically significant (P < 0.05).

Abbreviations: MDR, multiple-drug resistant; IMI-R, imipenem-resistant.

Figure 1 The neighbor-joining dendrogram (Boot strap: 1000) of two bla_NDM-1 harboring isolates.

Magiorakos A-P, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–281. doi:10.1111/j.1469-0691.2011.03570.x21793988

 PubMed Web of Science ®Google Scholar

Hujer KM, Hujer AM, Hulten EA, et al. Analysis of antibiotic resistance genes in multidrug-resistant Acinetobacter sp. isolates from military and civilian patients treated at the Walter Reed Army Medical Center. Antimicrob Agents Chemother. 2006;50(12):4114–4123. doi:10.1128/AAC.00778-0617000742

 PubMed Web of Science ®Google Scholar

Doyle D, Peirano G, Lascols C, Lloyd T, Church DL, Pitout JD. Laboratory detection of Enterobacteriaceae that produce carbapenemases. J Clin Microbiol. 2012;50(12):3877–3880. doi:10.1128/JCM.02117-1222993175

 PubMed Web of Science ®Google Scholar