Detection of Novel Gene Mutations Associated with Pyrazinamide Resistance in Multidrug-Resistant Mycobacterium tuberculosis Clinical Isolates in Southern China

Figures & data

Table 1 Primers and PCR Products of PZA-Associated Genes with Brief Explanatory Notes

Gene	Protein	Functional Activity	Primer Name	Oligonucleotide Sequence (5ʹ→3ʹ)	Product Size ~ (−200 to + 200)
pncA (Rv2043c)	Pyrazinamidase/nicotinamidase (PZase)	Convert amide into acid (PZA into POA)	pncA FpncA R	TCGCTCACTACATCACCGGC TCGTAGAAGCGGCCGATGGC	892 bp
rpsA (Rv1630)	30S ribosomal protein S1 (RpsA)	Trans-translation	rpsA F rpsA R	ACTGAGTGCCGAGCGTGCATC ACCGAACGCGTCGACCAGCG	1800 bp
panD (Rv3601c)	Aspartate alpha-decarboxylase (PanD)	Pantothenate biosynthesis	panD F panD R	TCGACTACCTGGAGCTGCGC TCGATCGTCAGTGCCAGTTC	755 bp
Rv2783c	Bifunctional protein polyribonucleotide Nucleotidyltransferase (GpsI, Pnpase) and synthesize and hydrolyze (p)ppGpp	Synthesis/degradation of ssDNA/ssRNA and (p)ppGpp	gpsI F gpsI R	ATTCAGACCTTTTCTCCTGGG GTCGACTTGAACAGCAAATG	2547 bp
clpC1 (Rv3596c)	ATP-dependent protease ATP-binding subunit (ClpC1)	Hydrolyses proteins in presence of ATP	clpC1 F clpC1 R	ACGCTTGGGTGGTTTTCTCGTT ACAAACCGACGTCAGCAGAGT	2816 bp
*Rv2044c-pncA-Rv2042c	Conserved hypothetical protein- PZase- Conserved protein		EO pncA F EO pncA R	GTGCCGCATCGAGTTCGATCCGCA GATATCGGGATAGCGCCGCTGGA	2070 bp

Notes: Primers were based on the M. tuberculosis H37Rv genome sequence (Accession No.: NC_000962; Version: NC_000962.3). *Entire operon of pncA.

Table 2 Prevalence of MDR, Pre-XDR and XDR TB in PZA^R Strains

Drug Resistance Profile	Total Isolates	PZA^R Isolates	Proportion (%)	PZA^S Isolates	Proportion (%)
MDR TB	113	78	69.02*	35	30.97
Pre-XDR TB	195	119	61.02*	76	38.97*
XDR TB	70	29	41.42	41	58.57*
Varied pattern^#	70	43	61.42	27	38.57
Total	448	269	60.04	179	39.95

Notes: *Indicates significantly higher rate than XDR TB in PZA^R isolates while in PZA^S isolates significantly higher rate than MDR TB measured by Chi-square test. # shows the number of drug-resistant strains with several distinct combinations of resistance against tested anti-TB drugs. MDR TB: M. tuberculosis strain resistant to at least INH and RIF. Pre-XDR TB: MDR strain additionally resistant to either a fluoroquinolone (FQ) or a second-line injectable drug but not both at the same time. XDR TB: MDR TB along with resistant to any fluoroquinolone (FQ) and at least one injectable second-line drug (e.g. amikacin, kanamycin, etc.) simultaneously.

Table 3 Distribution of Beijing and Non-Beijing Genotypes

Genotype	Total Isolates		PZA^R Isolates n =269	Proportion (%)	PZA^S Isolates n = 179	Proportion (%)
	n = 448	Proportion (%)
Beijing genotype	361	80.58	224	83.3*	137	76.5
Non-Beijing genotype	87	19.42	45	16.7	42	23.5

Note: * Beijing genotype is significantly higher in PZA^R isolates measured by Chi-square test.

Table 4 Correlation of Genotypic Susceptibility Testing and PZase Activity Assay

PZase Activity	PZA^R Isolates								Total
	No Mutation	Mutants
	WT Genes	pncA		Rv2044c	rpsA	panD	Rv2783c	clpC1
UFR	pncA
No. of strains	26	11	216	2	7	4	3	–	269
PZase negative	9	7	211	2	–	–	–	–	229
PZase positive	17	4	5	–	7	4	3	–	40

Note: PZA^S strains (179/448) were observed with positive PZase activity.

Abbreviations: PZase, pyrazinamidase; UFR, upstream flanking region of pncA.

Figure 1 Depiction of mutations in Rv2044c-pncA-Rv2042c operon in PZA^R strains. *Indicates the mutations exist only in Rv2044c or upstream flanking region of pncA^wt in PZA^R M. tuberculosis strains. The remaining mutations in operon exist along with the mutation(s) in pncA coding region. # indicates the novel mutations. Small arrows near the dotted lines direct the forward and reverse primers used for amplification of required fragments. PZase activity is shown by letters; N (negative), P (positive), WP (weakly positive).

Table 5 Evaluation of Sequencing Method and Phenotypic Susceptibility Testing for Detection of PZA Resistance

Locus	PZA^R Isolates n=269		PZA^S Isolates n=179		% Sensitivity (95% CI)	% Specificity (95% CI)	% Accuracy (95% of CI)
	Nonsynonymous Mutation & Indel	Wildtype or Synonymous Mutation	Nonsynonymous Mutation & Indel	Wildtype or Synonymous Mutation
UFR	11 (4.08)	258 (95.91)	0 (0.0)	179 (100)	4.09 (2.06–7.20)	100 (97.96–100.0)	42.41 (37.79–47.14)
pncA + UFR	12 (4.46)	257 (95.53)	0 (0.0)	179 (100)	4.46 (2.33–7.66)	100 (97.96–100.0)	42.63 (38.0–47.36)
pncA^c	202 (75.09)	67 (24.90)	7 (3.91)	172 (96.08)	75.09 (69.48–80.14)	96.09 (92.11–98.41)	83.48 (79.71–86.80)
pncA*	225 (83.64)	44 (16.35)	7 (3.91)	172 (96.08)	83.64 (78.67–87.86)	96.09 (92.11–98.41)	88.62 (85.30–91.41)
Rv2044c	2 (0.74)	267 (99.25)	0	179 (100)	0.74 (0.09–2.66)	100 (97.96–100.0)	40.40 (35.82–45.11)
rpsA	7 (2.60)	262 (97.39)	0	179 (100)	2.60 (1.05–5.29)	100 (97.96–100.0)	41.52 (36.91–46.24)
panD	4 (1.48)	265 (98.51)	0	179 (100)	1.49 (0.41–3.76)	100 (97.96–100.0)	40.85 (36.26–45.56)
Rv2783c	3 (1.11)	266 (98.88)	0	179 (100)	1.12 (0.23–3.22)	100 (97.96–100.0)	40.62 (36.04–45.33)
clpC1	0 (0.0)	269 (100)	0	179 (100)	0 (0–1.36)	100 (97.96–100)	39.96 (35.39–44.66)
All*	241 (89.59%)	28 (10.40%)	7 (3.91)	172 (96.08)	89.59 (85.31–92.97)	96.09 (92.11–98.41)	92.19 (89.30–94.50)

Notes: UFR = represents the strains with mutations only in UFR of pncA. pncA + UFR = represents the strains having mutations both in UFR and pncA. pncA^C = represents the strains containing the mutations only in the coding region of pncA. pncA* = represents the combined evaluation of strains covering the entire coding region of pncA and UFR together. All*= Combined evaluation of all genes.

Abbreviations: PZA^R, PZA-resistant; PZA^S, PZA-susceptible; UFR, Upstream flanking region; Indel, Insertion, deletion; 95% CI, 95% Confidence interval.