Prevalence of Virulence Genes and Their Association with Antimicrobial Resistance Among Pathogenic E. coli Isolated from Egyptian Patients with Different Clinical Infections

Figures & data

Table 1 List of Primers Used in This Study

Name of Gene	Primer Sequence	Amplicon Size	PCR Condition	Reference
Colicin V	F:CACACACAAACGGGAGCTGTT R:CTTCCCGCAGCATAGTTCCAT	680 bp	35 cycles of 94 ºC for 30s, 55 ºC for 30 s, 72 ºC for 1 min	(Johnson and Stell, 2000) [35]
Colicin Ia/Ib	F:ACGTATTACAAATCCCGGTGC R:CTTTTTCCTTCAACAGGGCA	1250 bp	35 cycles of 94 ºC for 30s, 55 ºC for 30 s, 72 ºC for 1 min	(Schamberger and Diez-Gonzalez, 2004) [36]
Colicin B	F:AAGAAAATGACGAGAAGACG R:GAAAGACCAAAGGCTATAAGG	493 bp	35 cycles of 94 ºC for 30s, 55 ºC for 30 s, 72 ºC for 1 min	(Schamberger and Diez-Gonzalez, 2004) [36]
Colicin M	F:CATCACCATCAACTAACTTACC R:CTCTTTACCAGAAAACATCG	737 bp	35 cycles of 94 ºC for 30s, 55 ºC for 30 s, 72 ºC for 1 min	(Schamberger and Diez-Gonzalez, 2004) [36]
Colicin E1	F:TTTGAATGGTACTCCTGACGG R:GTTCCAGCAAGCAAGCTAAA	1398 bp	35 cycles of 94 ºC for 30s, 55 ºC for 30 s, 72 ºC for 1 min	(Schamberger and Diez-Gonzalez, 2004) [36]
Colicin E2-E9	F:CGACAGGCTAAAGCTGTTCAGGT R:TGCAGCAGCATCAAATGCAGCCT	219 bp	35 cycles of 94 ºC for 1 min, 60 ºC for 1 min, 72 ºC for 1 min	(Tahamtan et al, 2012) [40]
crl	F:TTTCGATTGTCTGGCTGTAT R:CTTCAGATTCAGCGTCGTC	250 bp	30 cycles of 94 ºC for 40 s, 52ºC for 40 s, 72ºC for 45 s	(Pal and Singh, 2007) [12]
csgA	F:ACTCTGACTTGACTATTACC R:AGATGCAGTCTGGTCAAC	200 bp	30 cycles of 94 ºC for 1 min, 48ºC for 1min, 72ºC for 1 min	(Pal and Singh, 2007) [12]
fimH	F:TGCAGAACGGATAAGCCGTGG R:GCAGTCACCTGCCCTCCGGTA	508 bp	25 cycles of 94ºC for 30s, 63 ºC for 30 s, 68 ºC for 3min	(Johnson and Stell, 2000) [35]
hlyA	F:AACAAGGATAAGCACTGTTCTGGCT R:ACCATATAAGCGGTCATTCCCGTCA	1177 bp	25 cycles of 94ºC for 30s, 63 ºC for 30 s, 68 ºC for 3min	(Yamamoto et al, 1995) [34]
traT	F:GGTGTGGTGCGATGAGCACAG R:CACGGTTCAGCCATCCCTGAG	290 bp	25 cycles of 94ºC for 30s, 63 ºC for 30 s, 68 ºC for 3min	(Johnson and Stell, 2000) [35]
bla−OXA-2	F: AAGAA ACGCTACTCGCCTGC R: CCACTCAACCCATC CTACCC′	478 bp	40 cycles of 94 ºC for 1 min, 55ºC for 1min, 72ºC for 1 min	(Bhattacharjee et al, 2007) [38]
bla−OXA-10	F:TCTTTCGAGTACGGCATTAGC R:CCA ATGATGCCCTCACTTTCC	760bp	35 cycles of 96 ºC for 1 min, 56ºC for 1min, 72ºC for 1 min	(Lin et al, 2012) [39]
bla−CTX-M-5	F:CGCTTTGCGATGTGCAG R:ACCGCGATATCGTTGGT	550 bp	40 cycles of 94 ºC for 1 min, 55ºC for 1min, 72ºC for 1 min	(Bhattacharjee et al, 2007) [38]

Table 2 Distribution of Virulence Properties Among E. coli Clinical Isolates Collected from Different Infections

Virulence Properties	Samples (N= 64)				P-value	Total
	Urine (n=22) N (%)*	Stool (n=23) N (%)*	Blood (n=9) N (%)*	Wound Swabs (n=10) N (%)*		N (%)**
Hemolysis	19 (86.3)	2 (8.6)	4 (44.4)	2 (20)	<0.001*	27 (42.1)
Colicin production	17 (77.2)	20 (86.9)	5 (50)	6 (60)	0.185	58 (90.6)
MRHA test	14 (63.6)	12 (52.2)	5 (55.5)	5 (50)	0.849	36 (56.2)
Mannose sensitivity	13 (59)	8 (34.7)	6 (66.6)	6(60)	0.241	33 (51.5)
Curli fimbriae production	20 (90.9)	19 (82.6)	6 (66.6)	6 (60)	0.160	51 (79.6)
Cell surface hydrophobicity	18 (81.8)	20 (86.9)	8 (88.8)	6 (60)	0.283	52 (81.2)
Protease production	7 (31.8)	9 (39.1)	2 (22.2)	3 (30)	0.821	21 (32.8)
Biofilm Weak/None Moderate High	9 (40.9) 8 (36.3) 5 (22.7)	10 (43.4) 8 (34.7) 5 (21.7)	3 (33.3) 4 (44.4) 2 (22.2)	2 (20) 3 (30) 1 (10)	0.978	24 (37.5) 23 (35.9) 13 (20.3)

Notes: *Percentages were correlated to the total number of each type of samples. **Percentages were correlated to the total number of E. coli isolate. P values are significant at <0.05.

Abbreviation: MRHA, Mannose Resistant Hemagglutination test.

Table 3 Distribution of Virulence Genes Among E. coli Clinical Isolates Collected from Different Infections

Virulence Genes	Samples				P-value	Total (n = 64) N (%)**
	Urine (n=22) N (%)*	Stool (n=23) N (%)*	Blood (n=9) N (%)*	Wound Swabs (n=10) N (%) *
Colicin genes:
Col M	4 (18.2)	0 (0)	0 (0)	2 (20)	0.109	5 (7.8)
Col B	4 (18.2)	0 (0)	0 (0)	1 (10)	0.084	6 (9.3)
Col V	4 (18.2)	14 (60.8)	5 (55.5)	4 (40)	0.027*	27 (42.1)
Col E1	8 (36.4)	18 (78.3)	0 (0)	3 (30)	0.001*	29 (45.3)
Col E2-E9	4 (18.2)	15 (65.2)	0 (0)	1 (10)	<0.001*	20 (31.25)
Col la-lb	8 (36.4)	19 (82.6)	2 (22.2)	5 (50)	0.003*	34 (53.1)
Other virulence genes
fimH	20 (90.9)	18 (78.3)	6 (66.6)	4 (40)	0.019*	48 (75)
HlyA	18 (81.8)	4 (17.4)	5 (55.5)	2 (20)	<0.001*	29 (45.3)
traT	13 (59.1)	7 (30.4)	5 (55.5)	4 (40)	0.237	29 (45.3)
CsgA	20 (90.9)	18 (78.3)	8 (88.8)	4 (40)	0.011*	50 (78.1)
Crl	19 (86.4)	17 (73.9)	8 (88.8)	5 (50)	0.114	49 (76.5)
No virulence genes found in each isolate
0	2 (9)	3 (13)	1 (11.1)	3 (30)	0.451	9 (14)
1	0 (0)	2 (8.6)	2 (22.2)	2 (20)	0.147	6 (9.3)
2	2 (9)	3 (13)	1 (11.1)	2 (20)	0.857	8 (12.5)
3	10 (45.4)	7 (30.4)	2 (22.2)	0 (0)	0.069	19 (29.6)
4	1 (4.5)	1 (4.3)	0 (0)	0 (0)	0.999	2 (3.1)
5	1 (4.5)	2 (8.6)	0 (0)	0 (0)	0.999	3 (4.6)
6	0 (0)	0 (0)	1 (11.1)	0 (0)	0.999	1 (1.5)
7	1 (4.5)	2 (8.6)	2 (22.2)	1 (10)	0.499	6 (9.3)
8	1 (4.5)	1 (4.3)	0 (0)	0 (0)	0.499	2 (3.1)

Notes: *Percentages were correlated to the total number of E. coli isolated from each type of samples. **Percentages were correlated to the total number of E. coli isolates. P values are significant at <0.05.

Figure 1 Virulence genotypes of the tested E. coli isolates based on the type of samples. (A): Stool and urine samples. (B): Wound and urine samples. (C): Blood and urine samples. (D): Blood and stool samples. (E): Wound and stool samples. (F): Blood and wound samples.

Figure 2 Distribution of antibiotic resistance among E. coli clinical isolates of different sources.

Table 4 Distribution of ESBL Production and Resistance Genes Among the Isolated E. coli from Different Sources

	Source of Isolates				P-value
	Urine (n=22) N (%)*	Stool (n=23) N (%)*	Blood (n=9) N (%)*	Wound Swabs (n=10) N (%) *
ESBL Producers	12 (54.5)	10 (43.4)	5 (55.5)	3 (30)	0.672
Resistance Genes
bla-CTX-M-15	8 (36.3)	6 (26)	4 (44.4)	3 (30)	0.756
bla-OXA-2 like	3 (13.6)	0 (0)	2 (22.2)	1 (10)	0.203
bla-OXA-10 like	2 (9)	1 (4.3)	2 (22.2)	0 (0)	0.999
bla-CTX-M-15 + bla-OXA-2 like	2 (9)	0 (0)	2 (22.2)	1 (10)	0.999
bla-CTX-M-15 + bla-OXA-10 like	1 (4.5)	0 (0)	1 (11.1)	1 (10)	0.999
bla-OXA-2 like+ bla-OXA-10 like	0 (0)	0 (0)	0 (0)	0 (0)	0.999

Notes: *Percentages were correlated to the total number of E. coli isolated from each type of samples. P values are significant at <0.05.

Table 5 Relationships Between Virulence Factors Genes and Resistance Genes in Uropathogenic E. coli Isolates

	Correlations
	colM	colB	colV	colE1	colE2-E9	colIa-lb	fimH	hlyA	traT	CsgA	Crl	bla−CTX-M-15	bla−oxa-2	bla−oxa-10
ColM	NA	0.681**	0.550*	0.719**	0.586*	0.540*	0.568*	0.559*	0.678**	0.658*	0.477	0.617**	0.861*	0.693**
ColB		NA	0.747**	0.851**	0.609*	0.767**	0.466	0.611*	0.572*	0.671**	0.797**	0.668	0.853**	0.517**
ColV			NA	0.774**	0.677**	0.788**	0.673**	0.515	0.690**	0.479	0.746*	0.717**	0.657	0.256**
Col E1				NA	0.672**	0.821**	0.549*	0.591*	0.743**	0.595*	0.722**	0.670**	0.814**	0.494
Col E2-E9					NA	0.665**	0.422	0.445	0.518	0.667**	0.584*	0.775*	0.615**	0.372**
Col Ia-Ib						NA	0.289	0.691**	0.667**	0.767**	0.668*	0.788**	0.661**	0.418**
fimH							NA	0.309	0.715**	0.187	0.350*	0.454	0.437**	0.023*
hlyA								NA	0.545*	0.749**	0.520*	0.538*	0.557	0.250*
traT									NA	0.511	0.254	0.551	0.508	0.116
CsgA										NA	0.430	0.744	0.677	0.466
Crl											NA	0.683	0.736	0.571
bla−CTX-M-15												NA	0.635	0.501
bla-Oxa-2													NA	0.750
bla−Oxa-10														NA

Notes: Statistical analysis of associations between virulence factors (VFs). P values were calculated by Fisher’s exact test. *Correlation is significant at 0.05 level (2-tailed). **Correlation is significant at 0.01 level (2-tailed).

Abbreviation: NA, not applicable.

Table 6 Relationships Between Virulence Factors Genes and Resistance Genes in E. coli Isolated from Wound Samples

	Correlations
	colM	colB	colV	colE1	colE2-E9	colIa-lb	fimH	hlyA	traT	CsgA	Crl	bla−CTX-M-15	bla−oxa-2	bla−oxa-10
ColM	NA	0.147	0.505	−0.048	0.222	−0.184	0.471	0.167	0.427	0.059	−0.050	0.615	0.577	0.417
ColB		NA	0.387	0.576*	0.079	0.040	0.531	0.059	0.151	0.458	0.354	0.165	0.000	0.079*
ColV			NA	0.569*	0.014	−0.293	0.499	−0.063	0.121	0.099	−0.025	0.461	0.438	0.309*
Col E1				NA	0.176	−0.081	0.314	0.216	0.177	0.610*	0.489	0.348*	−0.083*	0.288
Col E2-E9					NA	0.642*	0.609*	0.556*	0.552*	0.380	0.378	0.368	0.192	0.481
Col Ia-Ib						NA	0.450	0.184	0.154	0.287	0.430	−0.115	−0.294	−0.151
fimH							NA		0.881**	0.491	0.265	0.518	0.408	0.471
hlyA								NA	0.881**	0.576*	0.400	0.722	0.289	0.750
traT									NA	0.465	0.352	0.850	0.462	0.801
CsgA										NA	0.636	0.430	−0.136	0.288
Crl											NA	0.289	−0.231	0.144
bla−CTX-M-15												NA	0.662	0.863
bla-Oxa-2													NA	0.770
bla−Oxa-10														NA

Notes: Statistical analysis of associations between virulence factors (VFs). P values were calculated by Fisher’s exact test. *Correlation is significant at 0.05 level (2-tailed). **Correlation is significant at 0.01 level (2-tailed).

Abbreviation: NA, not applicable.

Table 7 Relationships Between Virulence Factors Genes and Resistance Genes in Fecal E. coli Isolates

	Correlations
	colM	colB	colV	colE1	colE2-E9	colIa-lb	fimH	hlyA	traT	CsgA	Crl	bla−CTX-M-15	bla−oxa-2	bla−oxa-10
ColM	NA	–	0.487	0.552*	0.636*	0.616*	0.574*	0.208	0.132	0.366	0.371	0.018^a	.	−0.245*
ColB	–	NA	–	–	–	–	–	–	–	–	–	–	–	–
ColV			NA	0.423	0.600*	0.680**	0.458	0.269	0.221	0.434	0.545	−0.144^a	–	0.063
Col E1				NA	0.260	0.384	0.298	0.057	−0.007	0.206	0.212*	0.090^a	–	0.134
Col E2-E9					NA	0.972**	0.226	0.037	−0.016	0.187	0.129*	−0.215^a	–	−0.394
Col Ia-Ib						NA	0.196	−0.013	−0.019	0.182	0.158*	−0.251^a	–	−0.380
fimH							NA	0.719**	0.740**	0.825**	0.857*	−0.057^a	–	0.224
hlyA								NA	0.859**	0.843**	0.847	−0.288^a	–	0.168
traT									NA	0.833	0.905	−0.265	–	0.155
CsgA										NA	0.918	−0.234	–	0.116
Crl											NA	−0.252	–	0.160
bla−CTX-M-15												NA	–	0.714
bla-Oxa-2													NA	–
bla−Oxa-10													.	NA

Notes: Statistical analysis of associations between virulence factors (VFs). P values were calculated by Fisher’s exact test. *Correlation is significant at 0.05 level (2-tailed). **Correlation is significant at 0.01 level (2-tailed). ^aCannot be computed because at least one variable is constant.

Abbreviation: NA, not applicable.

Table 8 Relationships Between Virulence Factors Genes and Resistance Genes in E. coli Isolated from Blood Samples

	Correlations
	colM	colB	colV	colE1	colE2-E9	colIa-lb	fimH	hlyA	traT	CsgA	Crl	bla−CTX-M-15	bla−oxa-2	bla−oxa-10
ColM	NA	–	–	–	–	–	–	–	–	–	–	–	–	–
ColB		NA	–	–	–	–	–	–	–	–	–	–	–	–
ColV			NA	–	–	0.695**	0.944**	0.892**	0.814**	0.866**	0.924^a	0.758^a	0.544	0.430^a
Col E1				NA	–	–	–	–	–	–	–	–	–	–
Col E2-E9					NA	–	–	–	–	–	–	–	–	–
Col Ia-Ib						NA	0.699**	0.678**	0.854**	0.817**	0.772^a	0.582^a	0.202**	0.243^a
fimH							NA	0.939**	0.823**	0.912**	0.977^a	0.603^a	0.448**	0.274^a
hlyA								NA	0.918**	0.885**	–	–	–	–
traT									NA	0.878	0.871	0.655	0.515	0.460
CsgA										NA	0.968	0.563	0.376	0.190
Crl											NA	0.578	0.408	0.253
bla−CTX-M-15												NA	0.815	0.666
bla-Oxa-2													NA	0.770
bla−Oxa-10														NA

Notes: Statistical analysis of associations between virulence factors (VFs). P values were calculated by Fisher’s exact test. *Correlation is significant at 0.05 level (2-tailed). **Correlation is significant at 0.01 level (2-tailed). ^aCannot be computed because at least one variable is constant.

Abbreviation: NA, not applicable.