Phenotypic and Genotypic Assessment of Antibiotic Resistance of Staphylococcus aureus Bacteria Isolated from Retail Meat

Figures & data

Table 1 PCR Protocol Used for Genotypic Assessment of Antibiotic Resistance

Target Gene	Primer Sequence (5ʹ–3ʹ)	PCR Product (bp)	PCR Programs	PCR Volume (50µL)
AacA-D	F: TAATCCAAGAGCAATAAGGGC R: GCCACACTATCATAACCACTA	227
ermA	F: AAGCGGTAAACCCCTCTGA R: TTCGCAAATCCCTTCTCAAC	190
tetK	F: GTAGCGACAATAGGTAATAGT R: GTAGTGACAATAAACCTCCTA	360
tetM	F: AGTGGAGCGATTACAGAA R: CATATGTCCTGGCGTGTCTA	158	1 cycle: 94 °C — 6 min 34 cycles: 95 °C — 50 s 55 °C — 70 s 72 °C — 60 s 1 cycle: 72 °C — 8 min	5 µL PCR buffer 10× 2 mM MgCl2 200 µM dNTP (Fermentas) 0.5 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 5 µL DNA template
msrA	F: GGCACAATAAGAGTGTTTAAAGG R: AAGTTATATCATGAATAGATTGTCCTGTT	940	1 cycle: 94 °C — 6 min 34 cycles: 95 °C — 60 s 50 °C — 70 s 72 °C — 70 s 1 cycle: 72 °C — 8 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
linA	F: GGTGGCTGGGGGGTAGATGTATTAACTGG R: GCTTCTTTTGAAATACATGGTATTTTTCGA	323	1 cycle: 94 °C — 6 min 30 cycles: 95 °C — 60 s 57 °C — 60 s 72 °C — 60 s 1 cycle: 72 °C — 10 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
blaZ	F: ACTTCAACACCTGCTGCTTTC R: TGACCACTTTTATCA CAACC	490	1 cycle: 94 °C — 5 min. 30 cycles: 94 °C — 20 s 60 °C — 30 s 72 °C — 90 s 1 cycle: 72 °C — 5 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
cat1	F: AGTTGCTCAATGTACCTATAACC R: TTGTAATTCATTAAGCATTCTGCC	547	1 cycle: 94 °C — 8 min 32 cycles: 95 °C — 60 s 55°C — 70 s 72 °C — 2 min 1 cycle: 72 °C — 8 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
gyrA	F: AATGAACAAGGTATGACACC R: TACGCGCTTCAGTATAACGC	223	1 cycle: 94 °C — 10 min 25 cycles: 94 °C — 20 s 52 °C — 20 s 72 °C — 50 s 1 cycle: 72 °C — 5 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
grlA	F: ACTTGAAGATGTTTTAGGTGAT R: TTAGG AAATCTTGATGGCAA	459
dfrA	F: CTCACGATAAACAAAGAGTCA R: CAATCATTGCTTCGTATAACG	201	1 cycle: 94 °C — 2 min 30 cycles: 94 °C — 60 s 50 °C — 60 s 72 °C — 60 s 1 cycle: 72 °C — 5 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template
rpoB	F: ACCGTCGTTTACGTTCTGTA R: TCAGTGATAGCATGTGTATC	460	1 cycle: 94 °C — 5 min 32 cycles: 94 °C — 60 s 56 °C — 45 s 72 °C — 60 s 1 cycle: 72 °C — 10 min	5 µL PCR buffer 10× 2 mM MgCl2 150 µM dNTP (Fermentas) 0.75 µM of each primer F & R 1.5 U Taq DNA polymerase (Fermentas) 3 µL DNA template

Note: Data from references ^15–21.

Table 2 Incidence of S. aureus in Diverse Kinds of Retail Meat Samples

Types of Retail Meat Samples	No. of Samples Collected	No. of Samples Positive for S. aureus (%)
Camel	100	4 (4)
Buffalo	100	16 (16)
Goat	100	6 (6)
Beef	100	13 (13)
Sheep	85	9 (10.58)
Total	485	48 (9.89)

Table 3 Phenotypic Profile of Antibiotic Resistance of S. aureus Isolates Recovered from Diverse Kinds of Retail Meat Samples

Origins (No. of S. aureus Strains)	No. (%) of Isolates Resistant to Each Antibiotic
	Penicillins	Aminoglycosides		Macrolides		Tetracyclines		Fluoroquinolones		Lincosamides	Folate inhibitors	Phenicols	Ansamycins
	P10	Gen	Amk	Azi	Ert	Tet	Dox	Cip	Lev	Clin	Tr-Sul	C30	Rif
Camel (4)	3 (75)	2 (50)	1 (25)	2 (50)	2 (50)	3 (75)	2 (50)	2 (50)	2 (50)	2 (50)	3 (75)	–	1 (25)
Buffalo (16)	12 (75)	11 (68.75)	7 (43.75)	4 (25)	8 (50)	13 (81.25)	7 (43.75)	7 (43.75)	4 (25)	6 (37.50)	6 (37.50)	2 (12.50)	4 (25)
Goat (6)	4 (66.66)	3 (50)	2 (33.33)	1 (16.66)	1 (16.66)	4 (66.66)	2 (33.33)	1 (16.66)	1 (16.66)	2 (33.33)	2 (33.33)	–	1 (16.66)
Beef (13)	10 (76.92)	8 (61.53)	6 (46.15)	4 (30.76)	6 (46.15)	11 (84.61)	5 (38.46)	5 (38.46)	3 (23.07)	3 (23.07)	5 (38.46)	1 (7.69)	4 (30.76)
Sheep (9)	6 (66.66)	5 (55.55)	3 (33.33)	1 (11.11)	1 (11.11)	7 (77.77)	2 ()	1 (11.11)	1 (11.11)	2 (22.22)	2 (22.22)	1 (11.11)	1 (11.11)
Total (48)	35 (72.91)	29 (60.41)	19 (39.58)	12 (25)	18 (37.50)	38 (79.16)	20 (41.66)	16 (33.33)	11 (22.91)	15 (31.25)	18 (37.50)	4 (8.33)	11 (22.91)

Abbreviation: P10, penicillin (10 µg/disk); Gen, gentamicin (10 µg/disk); Amk, amikacin (30 µg/disk); Azi, azithromycin (15 µg/disk); Ert, erythromycin (15 µg/disk); Tet, tetracycline (30 µg/disk); Dox, doxycycline (30 µg/disk); Cip, ciprofloxacin (5 µg/disk); Lev, levofloxacin (5 µg/disk); Clin, clindamycin (2 µg/disk); Tr-Sul, trimethoprim–sulfamethoxazole (25 µg/disk); C30, chloramphenicol (30 µg/disk); Rif, rifampin (5 µg/disk).

Table 4 Genotypic Profile of Antibiotic Resistance of S. aureus Isolates Recovered from Diverse Kinds of Retail Meat Samples

Origins (No. of S. aureus Strains)	No. (%) of Isolates Harbored Each Gene
	Aminoglycosides	Tetracyclines		Macrolides		Lincosamides	Penicillins	Folate inhibitors	Fluoroquinolones		Ansamycins	Phenicols
	aacA-D	tetK	tetM	msrA	ermA	linA	blaZ	dfrA	gyrA	grlA	rpoB	cat1
Camel (4)	1 (25)	2 (50)	1 (25)	1 (25)	2 (50)	1 (25)	3 (75)	1 (25)	1 (25)	1 (25)	1 (25)	–
Buffalo (16)	8 (50)	10 ()	4 (25)	2 (12.50)	5 (31.25)	3 (18.75)	9 (56.25)	3 (18.75)	4 (25)	2 (12.50)	2 (12.50)	1 (6.25)
Goat (6)	1 (16.66)	2 (33.33)	1 (16.66)	–	1 (16.66)	1 (16.66)	3 (50)	1 (16.66)	1 (16.66)	–	–	–
Beef (13)	4 (30.76)	7 (53.84)	3 (23.07)	2 (15.38)	4 (30.76)	1 (7.69)	8 (61.53)	2 (15.38)	3 (23.07)	2 (15.38)	1 (7.69)	1 (7.69)
Sheep (9)	2 (22.22)	4 (44.44)	1 (11.11)	1 (11.11)	1 (11.11)	1 (11.11)	5 (55.55)	1 (11.11)	1 (11.11)	1 (11.11)	1 (11.11)	–
Total (48)	16 (33.33)	25 (52.08)	10 (20.83)	6 (12.50)	13 (27.08)	7 (14.58)	28 (58.33)	8 (16.66)	10 (20.83)	6 (12.50)	5 (10.41)	2 (4.16)

Table 5 Summarizing the Isolation Rate of S. aureus in Different Types of Meat Samples Obtained from Previous Research

Type of Meat Samples	Isolation Rate of S. aureus (%)	Studied Region/Year	References
Camel	14.50	Egypt/2019	[^Citation35]
Camel	11.70	Ethiopia/2017	[^Citation36]
Buffalo	16.70	India/2017	[^Citation37]
Poultry	17.24	Saudi Arabia/2016	[^Citation38]
Camel	50
Lamb/mutton	20.83
Beef	13.04
Camel	10.70	Saudi Arabia/2019	[^Citation39]
Beef	20.50	United States/2011	[^Citation40]
Camel	45	Egypt/2019	[^Citation41]
Meat products	15.30–61.50	Iran/2019	[^Citation42]
Red meat	18	Libya/2019	[^Citation43]
Chicken	40
Beef	57.50	Iran/2013	[^Citation44]
Lamb	68.80
Goat	47.50
Camel	46
Chicken	40.50	Japan/2005	[^Citation45]
Camel	40	Nigeria/2016	[^Citation46]
Pork	47.70	China/2018	[^Citation47]
Beef	50.40
Poultry	67.90
Mutton	54.50
Beef	24.50	United States/2017	[^Citation34]
Chicken	13.50
Pork	22.60
Turkey	50.90
Beef	68	Denmark/2017	[^Citation31]
Beef	10.60	The Netherlands/2009	[^Citation26]
Veal	15.20
Lamb	6.20
Mutton	6.20
Pork	10.70
Chicken	16
Turkey	35.30
Fowl	3.40
Game	2.20
Beef	17.30	Turkey/2010	[^Citation48]
Poultry	63.60

Lina G, Quaglia A, Reverdy M-E, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrob Agent Chemotherap. 1999;43(5):1062–1066. doi:10.1128/AAC.43.5.1062

 PubMed Web of Science ®Google Scholar

Aboshkiwa M, Rowland G, Coleman G. Nucleotide sequence of the Staphylococcus aureus RNA polymerase rpoB gene and comparison of its predicted amino acid sequence with those of other bacteria. Biochim Biophys Acta. 1995;1262(1):73–78. doi:10.1016/0167-4781(95)00054-K7772603

 PubMed Web of Science ®Google Scholar

Al-Amery K, Elhariri M, Elsayed A, et al. Vancomycin-resistant Staphylococcus aureus isolated from camel meat and slaughterhouse workers in Egypt. Antimicrob Resist Infect Control. 2019;8(1):129. doi:10.1186/s13756-019-0585-431404199

 PubMed Web of Science ®Google Scholar

Beyene T, Hayishe H, Gizaw F, et al. Prevalence and antimicrobial resistance profile of Staphylococcus in dairy farms, abattoir and humans in Addis Ababa, Ethiopia. BMC Res Notes. 2017;10(1):171. doi:10.1186/s13104-017-2487-y28454589

 PubMedGoogle Scholar

Kumar A, Kaushik P, Anjay PK, Kumar M. Prevalence of methicillin-resistant Staphylococcus aureus skin and nasal carriage isolates from bovines and its antibiogram. Vet World. 2017;10(6):593–597. doi:10.14202/vetworld.2017.593-59728717308

 PubMed Web of Science ®Google Scholar

Raji MA, Garaween G, Ehricht R, Monecke S, Shibl AM, Senok A. Genetic characterization of Staphylococcus aureus isolated from retail meat in Riyadh, Saudi Arabia. Front Microbiol. 2016;7:911. doi:10.3389/fmicb.2016.0091127375611

 PubMed Web of Science ®Google Scholar

El-Ghareeb WR, Almathen FS, Fayez MM, et al. Methicillin resistant Staphylococcus aureus (MRSA) in camel meat: prevalence and antibiotic susceptibility. Slov Vet Res. 2019;56(Suppl 22):249–256.

 Google Scholar

Bhargava K, Wang X, Donabedian S, Zervos M, da Rocha L, Zhang Y. Methicillin-resistant Staphylococcus aureus in retail meat, Detroit, Michigan, USA. Emerg Infect Dis. 2011;17(6):1135–1137. doi:10.3201/eid1706.10190521749794

 PubMed Web of Science ®Google Scholar

Gwida M, Zakaria A, El-Sherbiny H, Elkenany R, Elsayed M. Prevalence of Campylobacter, Enterococcus and Staphylococcus aureus in slaughtered camels. Vet Med. 2019;64(12):521–530. doi:10.17221/104/2019-VETMED

 Web of Science ®Google Scholar

Mahfoozi A, Shirzad-Aski H, Kaboosi H, Ghaemi EA. Identification of the classical enterotoxin genes of Staphylococcus aureus in various foods by multiplex PCR assay. Iran J Vet Res. 2019;20(3):209–212.31656527

 PubMed Web of Science ®Google Scholar

Naas HT, Edarhoby RA, Garbaj AM, et al. Occurrence, characterization, and antibiogram of Staphylococcus aureus in meat, meat products, and some seafood from Libyan retail markets. Vet World. 2019;12(6):925–931. doi:10.14202/vetworld.2019.925-93131440015

 PubMed Web of Science ®Google Scholar

Rahimi E, Nonahal F, Salehi EA. Detection of classical enterotoxins of Staphylococcus aureus strains isolated from raw meat in Esfahan, Iran. Health Scope. 2013;2(2):95–98. doi:10.17795/jhealthscope-10651

 Google Scholar

Kitai S, Shimizu A, Kawano J, et al. Prevalence and characterization of Staphylococcus aureus and enterotoxigenic Staphylococcus aureus in retail raw chicken meat throughout Japan. J Vet Med Sci. 2005;67(3):269–274. doi:10.1292/jvms.67.26915805729

 PubMed Web of Science ®Google Scholar

Yusuf S, Kwaga JKP, Bello M, et al. Occurrence of methicillin-resistant Staphylococcus aureus in camels slaughtered at Kano abattoir, Kano, Nigeria. Int J Vet Sci. 2016;4(1–2):1–14.

 Google Scholar

Wu S, Huang J, Wu Q, et al. Staphylococcus aureus isolated from retail meat and meat products in China: incidence, antibiotic resistance and genetic diversity. Front Microbiol. 2018;9:2767. doi:10.3389/fmicb.2018.0276730498486

 PubMed Web of Science ®Google Scholar

Ge B, Mukherjee S, Hsu C-H, et al. MRSA and multidrug-resistant Staphylococcus aureus in U.S. retail meats, 2010–2011. Food Microbiol. 2017;62:289–297. doi:10.1016/j.fm.2016.10.02927889161

 PubMed Web of Science ®Google Scholar

Tang Y, Larsen J, Kjeldgaard J, Andersen PS, Skov R, Ingmer H. Methicillin-resistant and -susceptible Staphylococcus aureus from retail meat in Denmark. Int J Food Microbiol. 2017;249:72–76. doi:10.1016/j.ijfoodmicro.2017.03.00128324679

 PubMed Web of Science ®Google Scholar

De Boer E, Zwartkruis-Nahuis J, Wit B, et al. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol. 2009;134(1–2):52–56. doi:10.1016/j.ijfoodmicro.2008.12.00719144432

 PubMed Web of Science ®Google Scholar

Guven K, Mutlu MB, Gulbandilar A, Cakir P. Occurrence and characterization of Staphylococcus aureus isolated from meat and dairy products consumed in Turkey. J Food Saf. 2010;30(1):196–212. doi:10.1111/j.1745-4565.2009.00200.x

 Web of Science ®Google Scholar