In vitro Antibiotic Susceptibility, Virulence Genes Distribution and Biofilm Production of Staphylococcus aureus Isolates from Bovine Mastitis in the Liaoning Province of China

Figures & data

Table 1 Primer Sequences and PCR Conditions Used in This Study

Primers	Primer Sequence (5ʹ→3ʹ)	Program^a	Size of PCR Product (bp)	Reference
spa-1113F	TAAAGACGATCCTTCGGTGAG	1	Variable	Aires-de-Sousa et al 2006^Citation40
spa-1514R	CAGCAGTAGTGCCGTTTGCTT
seaF	TTGGAAACGGTTAAAACGAA	2	120	Park et al, 2011^Citation42
seaR	GAACCTTCCCATCAAAAACA
sebF	TCGCATCAAACTGACAAACG	2	478	Park et al, 2011^Citation42
sebR	GCAGGTACTCTATAAGTGCC
secF	GCATAAAAGCTAGGAATTT	2	257	Park et al, 2011^Citation38
secR	AAATCGGATTAACATTATCC
sedF	CTAGTTTGGTAATATCTCCT	2	317	Park et al, 2011^Citation42
sedR	TAATGCTATATCTTATAGGG
segF	AATTATGTGAATGCTCAACCCGATC	2	642	Park et al, 2011^Citation42
segR	AAACTTATATGGAACAAAAGGTACTAGTTC
tsst-1F	ATGGCAGCATCAGCTTGATA	2	350	Park et al, 2011^Citation42
tsst-1R	TTTCCAATAACCACCCGTTT
bbpF	AACTACATCTAGTACTCAACAACAG	3	575	Tristan et al, 2003^Citation43
bbpR	ATGTGCTTGAATAACACCATCATCT
cnaF	GTCAAGCAGTTATTAACACCAGAC	3	423	Tristan et al, 2003^Citation43
cnaR	AATCAGTAATTGCACTTTGTCCACTG
fnbAF	GTGAAGTTTTAGAAGGTGGAAAGATTAG	4	643	Tristan et al, 2003^Citation43
fnbAR	GCTCTTGTAAGACCATTTTTCTTCAC
fnbBF	GTAACAGCTAATGGTCGAATTGATACT	4	524	Tristan et al, 2003^Citation43
fnbBR	CAAGTTCGATAGGAGTACTATGTTC
clfAF	ATTGGCGTGGCTTCAGTGCT	4	292	Tristan et al, 2003^Citation43
clfAR	CGTTTCTTCCGTAGTTGCATTTG
clfBF	ACATCAGTAATAGTAGGGGGCAAC	4	205	Tristan et al, 2003^Citation43
clfBR	TTCGCACTGTTTGTGTTTGCAC
hlaF	CTGATTACTATCCAAGAAATTCGATTG	5	209	Jarraud et al, 2002^Citation41
hlaR	CTTTCCAGCCTACTTTTTTATCAGT
hlbF	GTGCACTTACTGACAATAGTGC	5	309	Jarraud et al, 2002^Citation41
hlbR	GTTGATGAGTAGCTACCTTCAGT
hldF	AAGAATTTTTATCTTAATTAAGGAAGGAGTG	5	111	Jarraud et al, 2002^Citation41
hldR	TTAGTGAATTTGTTCACTGTGTCGA
hlgAF	GTCAYAGAGTCCATAATGCATTTAA	5	535	Jarraud et al, 2002^Citation41
hlgAR	CACCAAATGTATAGCCTAAAGTG
lukAF	GAAGTATCTAATACTTCTTTAGCAGC	6	625	da Costa et al, 2014^Citation34
lukAR	TCATTTGACAATTCTACACTTCCAAC
lukBF	TGAAAAAGGTTCAAAGTTGATACGAG	6	433	da Costa et al, 2014^Citation34
lukBR	TGTATTCGATAGCAAAAGCAGTGCA

Notes: ^aPCR program. 1: 1×(94ºC, 600s), 30×(94ºC, 20s, 62ºC, 20s, 72ºC, 30s), 1×(72ºC, 600s). 2: 1×(94ºC, 600s), 35×(94ºC, 60s, 55ºC, 60s, 72ºC, 60s), 1×(72ºC, 300s). 3: 1×(94ºC, 600s), 30×(94ºC, 60s, 58ºC, 120s, 72ºC, 60s), 1×(72ºC, 600s). 4: 1×(94ºC, 600s), 30×(94ºC, 60s, 52ºC, 60s, 72ºC, 60s), 1×(72ºC, 600s). 5: 1×(94ºC, 180s), 35×(94ºC, 60s, 60ºC, 60s, 72ºC, 180s), 1×(72ºC, 420s). 6: 1×(94ºC, 180s), 35×(94ºC, 60s, 57ºC, 60s, 72ºC, 180s), 1×(72ºC, 420s).

Table 2 Dilution Range and Susceptibility Breakpoints of Antimicrobial Agents Used in This Study

Antimicrobial Agent	Dilution Range (μg/mL)	Susceptibility Break Points (μg/mL)
		Susceptible	Intermediate	Resistant
Penicillin^a	0.03–64	≤0.12		≥0.25
Oxacillin^b	0.03–64	≤2		≥4
Sulfamethoxazole^a	0.12–128	≤64		≥128
Tetracycline^a	0.03–64	≤4	8	≥16
Enrofloxacin^a	0.03–16	≤0.25	0.5–1	≥2
Amoxicillin/clavulanate^b	0.03–64	≤2	2/4	≥8
Cefalexin^d	0.03–64	≤2	4	≥8
Ceftiofur^a	0.03–64	≤2^4	4	≥8
Clindamycin^b	0.03–64	≤2	1–2	≥4
Daptomycin^c	0.03–64	≤1	1–2	≥2

Notes: ^aInterpretative breakpoint based on the CLSI breakpoints used in veterinary medicine; ^binterpretative breakpoint based on the CLSI breakpoints used in human medicine; ^cinterpretative break point based on EUCAST, 2015;^{44 d}breakpoint of cefalexin based on cephalothin.

Table 3 Spa Type and Biofilm Production of the Staph. Aureus Isolates

Spa Type	Number of Isolates	Biofilm Formation
t267	19	1.07±0.16
t730	12	0.38±0.12
t518	8	1.02±0.29
t1190	6	0.67±0.17
t1456	5	0.46±0.19
t224	1	1.14±0.37
t9129	1	0.42±0.15
t177	1	0.64±0.24

Table 4 Minimum Inhibitory Concentrations (μg/mL) of the Staph. Aureus Isolates from the Milk of Dairy Cows with Mastitis (56 Isolates)

Notes: The dilution ranges tested are those contained within the light blue area, and the concentrations of the different antimicrobial agents are illustrated in the light gray area. The breakpoints were employed according to VET01S, 3rd ed, human, daptomycin was interpreted according to EUCAST, and the breakpoint of cefalexin was based on cephalothin. When available, susceptible and resistance breakpoints are indicated by the vertical green and red line, respectively. The dashed vertical green line represents the breakpoints from humans.

Figure 1 Boxplots of the in vitro biofilm production of Staph. aureus strains of the major spa types (n≥5). Each dot represents one strain. Biofilm production was different among the main spa types, especially spa types t730 and t1456, which produced less biofilm than the other main spa type. Significance was determined by an ANOVA test (* P<0.05; ** P<0.01).

Figure 2 Confocal laser scanning microscopy of in vitro biofilm production of Staph. aureus isolates. The biofilms were stained with LIVE/DEAD stain. Green represents live cells, red represents dead cells and eDNA, and yellow represents a mixture. (A) SA0007; (B) SA0012; (C) SA0019; (D) SA0020; (E) SA0023; (F) SA0028; (G) SA0031; (H) SA0047; (I) SA0052.

Aires-de-Sousa M, Boye K, de Lencastre H, et al. High interlaboratory reproducibility of DNA sequence-based typing of bacteria in a multicenter study. J Clin Microbiol. 2006;44(2):619–621. doi:10.1128/JCM.44.2.619-621.200616455927

 PubMed Web of Science ®Google Scholar

Park JY, Fox LK, Seo KS, et al. Detection of classical and newly described staphylococcal superantigen genes in coagulase-negative staphylococci isolated from bovine intramammary infections. Vet Microbiol. 2011;147(1–2):149–154. doi:10.1016/j.vetmic.2010.06.02120667668

 PubMed Web of Science ®Google Scholar

Huang CT, Yu FP, McFeters GA, Stewart PS. Nonuniform spatial patterns of respiratory activity within biofilms during disinfection. Appl Environ Microbiol. 1995;61(6):2252–2256. doi:10.1128/AEM.61.6.2252-2256.19957793945

 PubMed Web of Science ®Google Scholar

Tristan A, Ying L, Bes M, Etienne J, Vandenesch F, Lina G. Use of multiplex PCR to identify staphylococcus aureus adhesins involved in human hematogenous Infections. J Clin Microbiol. 2003;41(9):4465–4467. doi:10.1128/JCM.41.9.4465-4467.200312958296

 PubMed Web of Science ®Google Scholar

Jarraud S, Mougel C, Thioulouse J, et al. Relationships between Staphylococcus aureus genetic background virulence factors, agr groups (alleles), and human disease. Infect Immun. 2002;70(2):631–641. doi:10.1128/IAI.70.2.631-641.200211796592

 PubMed Web of Science ®Google Scholar

Da Costa LB, Rajala-Schultz PJ, Hoet A, Seo KS, Fogt K, Moon BS. Genetic relatedness and virulence factors of bovine Staphylococcus aureus isolated from teat skin and milk. J Dairy Sci. 2014;97(11):1–10. doi:10.3168/jds.2014-797224183685

 PubMed Web of Science ®Google Scholar

EUCAST. The European committee on antimicrobial susceptibility testing. http://www.eucast.org/. Accessed 914, 2018

 Google Scholar