Global Sequence Analysis and Expression of Azurin Gene in Different Clinical Specimens of Burn Patients with Pseudomonas aeruginosa Infection

Figures & data

Table 1 GenBbank Extracted Azurin Gene Sequences Analyzed in This Study

Origin	Number of Strains	Specimen Source
		Clinical	Environmental
USA	49	48	1
Singapore	14	11	3
Colombia	1	1	–
Brazil	6	6	–
Norway	1	1	–
Japan	3	1	2
Canada	2	2	–
India	4	4	–
Vietnam	3	–	3
Netherlands	3	3	–
China	7	3	4
Korea	3	3	–
Mexico	7	7	–
Germany	1	1	–
Sweden	1	1	–
Switzerland	3	3	–
Total	108	95	13

Table 2 Primer Sequences Used in This Study

Target Gene	Primer Sequence (5ʹ →3ʹ)	PCR Product Size (bp)	Reference	Amplification Assay
azurin	F: CCATGCTACGTAAACTCGCTGCGG R: CTTCAGGGTCAGGGTGCC	446	This study	PCR
azurin (Blu)	F: GGTGGACATCCAGGGTAACG R: ATGACGTTCTTCGGCAGGTT	120	This study	Real time-PCR
rpsl (Ribosomal protein S12)	F: GCAAGCGCATGGTCGACAAGA R: CGCTGTGCTCTTGCAGGTTGTGA	201	[^Citation23, ^Citation24]	Real time-PCR

Figure 1 The schematic representation of azurin gene and flanking regions. Position of primers for PCR amplification of azurin gene.

Table 3 Point Mutations Within the 446-Bp Segment of Azurin Gene in Iranian P. Aeruginosa Isolates in Relation to the Location of Isolation and Accession Numbers

Isolations	Accession Number	Province	Mutation Position
			51	241	243	282	297	298	304	306
PAO1	AE004091.2		A	A	C	G	T	G	G	C
ATCC27853	MK276602		G	G	A	G	T	G	A	A
1	MK276543	Tehran	G	G	A	A	T	G	A	A
2	MK276544	Tehran	G	A	A	A	T	G	A	A
3	MK276545	Tehran	G	A	C	A	T	G	A	A
4	MK276546	Tehran	G	A	C	G	C	G	A	A
5	MK276547	Tehran	G	A	C	G	G	G	A	A
6	MK276548	Tehran	G	A	C	A	T	G	A	A
7	MK276549	Tehran	G	A	C	A	T	G	A	A
8	MK276550	Tehran	G	A	C	A	T	G	A	A
9	MK276551	Tehran	G	A	C	A	T	G	A	A
10	MK276552	Tehran	G	A	C	A	T	G	A	A
11	MK276553	Tehran	G	A	C	A	T	G	A	A
12	MK276554	Tehran	G	A	C	G	C	G	A	A
13	MK276555	Tehran	G	A	C	A	T	G	A	A
14	MK276556	Tehran	G	A	C	A	T	G	A	A
15	MK276557	Tehran	G	A	C	A	T	G	A	A
16	MK276558	Tehran	G	A	A	A	T	G	A	A
17	MK276559	Tehran	G	A	C	G	T	G	A	A
18	MK276560	Tehran	G	A	A	G	C	G	A	A
19	MK276561	Tehran	G	A	C	A	T	G	A	A
20	MK276562	Tehran	G	A	C	A	T	G	G	C
21	MK276563	Tehran	G	A	C	G	C	G	G	C
22	MK276564	Tehran	G	A	C	A	T	G	A	A
23	MK276565	Tehran	G	A	C	G	C	G	A	A
24	MK276566	Tehran	G	A	C	A	T	G	G	C
25	MK276567	Tehran	G	A	C	A	T	G	G	C
26	MK276568	Tehran	G	A	C	G	T	G	G	C
27	MK276569	Tehran	G	A	C	G	T	G	G	C
28	MK276570	Tehran	G	A	C	G	C	G	G	C
29	MK276571	Tehran	G	A	C	G	C	G	G	C
30	MK276572	Tehran	G	A	C	A	C	G	G	C
31	MK276573	Tehran	G	A	C	A	T	G	G	C
32	MK276574	Isfahan	G	A	C	G	C	G	A	A
33	MK276575	Isfahan	G	A	C	G	C	G	G	A
34	MK276576	Isfahan	G	A	C	G	C	G	A	A
35	MK276577	Isfahan	G	A	C	A	T	G	A	A
36	MK276578	I Isfahan	A	A	C	G	T	G	A	A
37	MK276579	Isfahan	G	A	C	G	C	G	A	A
38	MK276580	Isfahan	G	A	A	A	T	G	A	A
39	MK276581	Isfahan	G	A	A	A	T	G	A	A
40	MK276582	Isfahan	G	A	C	G	C	G	A	A
41	MK276583	Isfahan	G	A	A	G	C	G	A	A
42	MK276584	Isfahan	G	A	C	A	T	G	A	A
43	MK276585	Isfahan	G	G	A	G	C	G	A	A
44	MK276586	Isfahan	G	A	C	G	C	G	A	A
45	MK276588	Isfahan	G	A	C	A	T	G	A	A
46	MK276589	Isfahan	A	A	C	G	T	G	A	A
47	MK276590	Isfahan	G	G	C	G	C	G	A	A
48	MK276591	Isfahan	G	G	A	G	C	G	A	A
49	MK276592	Isfahan	G	G	C	A	T	G	A	A
50	MK276593	Isfahan	G	G	C	G	C	G	A	A
51	MK276594	Isfahan	G	G	C	A	T	G	A	A
52	MK276595	Isfahan	G	G	C	G	C	A	A	A
53	MK276596	Isfahan	A	A	C	G	T	G	A	A
54	MK276597	Isfahan	G	G	A	A	T	G	A	A
55	MK276598	Isfahan	G	G	A	G	C	G	A	A
56	MK276599	Isfahan	G	G	A	G	C	G	A	A
57	MK276600	Isfahan	G	A	C	G	C	G	A	A
58	MK276601	Isfahan	G	A	A	G	C	G	A	A
59	MK276588	Isfahan	G	A	A	G	C	G	A	A
Total sequenced isolates			59 isolates and one P. aeruginosa ATCC27853

Table 4 The Frequency of Amino Acid Substitutions Among Iranian Azurin Protein Sequences

Strains	Amino Acids Substitution Site
	81					102
PAO1	.	.	T	.	.	.	.	A	.	.
ATCC 27853	.	.	A	.	.	.	.	T	.	.
37 strains (62.8%)	.	.	T	.	.	.	.	T	.	.
11 strains (18.6%)	.	.	A	.	.	.	.	T	.	.
11 strains (18.6%)	.	.	T	.	.	.	.	A	.	.
Total	59 isolates (100%)

Figure 2 PCR assay of azurin gene. Lanes 1–5: P. aeruginosa isolates, Lanes N and P: representatives of negative and positive controls. M: 100 bp DNA size marker.

Figure 3 UPGMA dendrogram of P. aeruginosa clinical strains based on the difference in the nucleotides of azurin gene sequences. P. aeruginosa ATCC27853 and PAO1 were used as control. Each strain is presented based on the geographical region of its isolation, clinical sample, and gene expression fold change. T: Tehran, I: Isfahan.

Figure 4 Circular dendrogram according to the global analysis of nucleotide polymorphism of azurin gene among P. aeruginosa strains. C and E next to the ID of the isolates determine the clinical and environmental sources of isolates. The geographical origin of the isolates is displayed using different colors.

Figure 5 The multidimensional layout of global analysis of azurin gene in different isolates of P. aeruginosa according to UPGMA algorithms.

Figure 6 The fold change of azurin gene expression in different P. aeruginosa clinical strains isolated from different specimens (wound, blood, catheter, and tissue). *p< 0.001.

Falagas ME, Koletsi PK, Bliziotis IA. The diversity of definitions of multidrug-resistant (MDR) and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J Med Microbiol. 2006;55(12):1619–1629. doi:10.1099/jmm.0.46747-017108263

 PubMed Web of Science ®Google Scholar

Dumas JL, Van Delden C, Perron K, et al. Analysis of antibiotic resistance gene expression in Pseudomonas aeruginosa by quantitative real-time-PCR. FEMS Microbiol Lett. 2006;254(2):217–225. doi:10.1111/j.1574-6968.2005.00008.x16445748

 PubMed Web of Science ®Google Scholar