Colonization by Pseudomonas aeruginosa and Staphylococcus aureus of Antral Biopsy Specimens from Gastritis Patients Uninfected with Helicobacter Pylori

Figures & data

Table 1 Primer Sequences and PCR Conditions

Microorganisms	Primer	Sequences	Conditions Including °C and Time (s)	PCR Product	Reference
S. aureus	nuc	GCGATTGATGGTGATACGGTT AGCCAAGCCTTGACGAACTAAAGC	95 for 60 59 for 45 72 for 50 32 cycles	279 bp	(^Citation26)
S. epidermidis	aap	ATGGGCAAACGTAGACAAGG GCTTTCGCTTCATGGCTACT	95 for 60s 59 for 45s 72 for 50s 36 cycles	155 bp	This study
P. aeruginosa	PA431C	CTGGGTCGAAAGGTGGTTGTTATC GCGGCTGGTGCGGCTGAGTC	94 for 60s 57 for 30s 72 for 56 35 cycles	232 bp	(^Citation27)
H. pylori	glmM	AAGCTTTTAGGGGTGTTAGGGGTTT AAGCTTACTTTCTAACACTAACGC	94 for 60s 58 for 30s 72 for 60s 34 cycles	294 bp	(^Citation25)

Table 2 Distribution of the Three Microorganisms Among Subjects Positive or Negative for H. Pylori

Patient Characteristics and Sample Colonization	With H. pylori	WithoutH. pylori	P value
n = 100	51%	49%	P > 0.05
S. aureus	18 (35.2%)	28 (57%)	P = 0.04
S. epidermidis	20 (39.2%)	24 (48.9%)	P = 0.42
P. aeruginosa	38 (74%)	45 (91.8%)	P = 0.03

Figure 1 Gel electrophoresis for PA431C gene to determine the prevalence of P. aeruginosa. The band size was 232 bp. Samples 5–8 were positive, whereas 3 and 4 were negative clinical samples.

Figure 2 Gel electrophoresis for nuc gene to determine the prevalence of S. aureus. The band size was 279 bp; sample 8 was the positive control. Samples 3, 5, and 7 were considered as positive clinical samples.

Table 3 Incidence of the Three Microorganisms Among Patients with the Three Digestive Conditions

H. pylori Status Disease Groups	H. pylori Positive (n = 51)				H. pylori Negative (n = 49)
	P. aeruginosa	S. epidermidis	S. aureus		P. aeruginosa	S. epidermidis	S. aureus
Gastritis (n = 62)	26	5	4		38	8	14
Duodenal ulcer (n = 18)	5	7	11		2	10	8
Gastric ulcer (n = 20)	7	8	3		5	6	6

Choi HJ, Kim MH, Cho MS, et al. Improved PCR for identification of Pseudomonas aeruginosa. Appl Microbiol Biotechnol. 2013;97(8):3643–3651. doi:10.1007/s00253-013-4709-023504075

 PubMed Web of Science ®Google Scholar

Wang T, Cai H, Sasazuki S, et al. Fruit and vegetable consumption, Helicobacter pylori antibodies, and gastric cancer risk: a pooled analysis of prospective studies in China, Japan, and Korea. Int J Cancer. 2017;140(3):591–599. doi:10.1002/ijc.3047727759938

 PubMed Web of Science ®Google Scholar

Lu JJ, Perng CL, Shyu RY, et al. Comparison of five PCR methods for detection of Helicobacter pylori DNA in gastric tissues. J Clin Microbiol. 1999;37(3):772–774.9986850

 PubMed Web of Science ®Google Scholar