Distribution of Class B and Class A β-Lactamases in Clinical Strains of Pseudomonas aeruginosa: Comparison of Phenotypic Methods and High-Resolution Melting Analysis (HRMA) Assay

Figures & data

Table 1 Oligonucleotide Sequences Used in This Study

Gene	Primer Name	Sequence of Primers	Melting Tm	Annealing Tm/Time	Product Size (bp)	References
blaSHV	SHV	F: TCCCATGATGAGCACCTTTAAA R: TCCTGCTGGCGATAGTGGAT	88.57±0.5°C	59	105	[^Citation5]
blaTEM	TEM	F: GCATCTTACGGATGGCATGA R: GTCCTCCGATCGTTGTCAGAA	82.4± 0.5°C	58	101	[^Citation5]
blaKPC	KPC	F: GATACCACGTTCCGTCTGG R: GCAGGTTCCGGTTTTGTCTC	83.55±0.5°C	60	254	[^Citation8]
blaIMP	IMP	F: GGCTTAATTCTCGATCTATCCC R: CTAGCCAATAGTTAACTCCGC	80.16±0.5°C	61	114	[^Citation3]
blaVIM	VIM	F: TCTCCACGCACTTTCATGAC R: GTGGGAATCTCGTTCCCCTC	88.57±0.5°C	60	124	[^Citation3]
blaGIM	GES	F: GTTTTGCAATGTGCTCAACG R: TGCCATAGCAATAGGCGTAG	86.86±0.5°C	61	387	12

Table 2 Antibiotic Susceptibility Profiles in Clinical Isolates of P. aeruginosa

Antibiotics Resistance	β-lactamase genes
	Total(%)			blaSHV(%)		blaTEM(%)		blaKPC(%)		blaIMP(%)		blaVIM(%)		blaGES(%)
	S	I	R	S	R	S	R	S	R	S	R	S	R	S	R
Ceftazidime	33(37.5%)	16(18.1%)	39(44.3%)	4(12.1%)	33(84.6%)	0(0%)	19(48.7%)	0(0%)	11(28.2%)	0(0%)	13(33.3%)	0(0%)	5(12.8%)	0(0%)	2(5.1%)
Doripenem	46(52.2%)	15(17.0%)	27(30.6%)	0(0%)	25(92.5%)	0(0%)	20(74.0%)	0(0%)	12(44.4%)	0(0%)	12(44.4%)	0(0%)	5(18.5%)	0(0%)	2(7.4%)
Meropenem	54(61.3%)	13(14.7%)	21(23.8%)	1(1.8%)	17(80.9%)	0(0%)	20(95.2%)	0(0%)	12(57.1%)	0(0%)	13(61.9%)	0(0%)	5(23.8%)	0(0%)	2(9.5%)
Imipenem	40(45.4%)	17(19.3%)	31(35.2%)	3(7.5%)	25(80.6%)	0(0%)	20(64.5%)	0(0%)	12(38.7%)	0(0%)	13(41.9%)	0(0%)	5(16.1%)	0(0%)	2(6.4%)
Cefepime	50(56.8%)	11(12.5%)	27(27.2%)	1(2.0%)	26(96.2%)	0(0%)	19(70.3%)	0(0%)	12(44.4%)	0(0%)	10(37.0%)	0(0%)	5(18.5%)	0(0%)	2(7.4%)
Gentamycin	18(20.4%)	11(12.5%)	59(67.0%)	0(0%)	39(66.1%)	1(5.5%)	18(31.0%)	0(0%)	12(20.3%)	0(0%)	13(22.0%)	0(0%)	5(8.4%)	0(0%)	2(3.3%)
Ciprofloxacin	12(13.6%)	9(10.2%)	67(76.1%)	0(0%)	39(58.2%)	0(0%)	20(29.8%)	0(0%)	12(17.9%)	0(0%)	13(19.4%)	0(0%)	5(7.4%)	0(0%)	2(2.9%)
Amikacin	52(59.1%)	17(19.3%)	19(21.5%)	0(0%)	15(78.9%)	1(1.9%)	15(78.9%)	0(0%)	12(63.1%)	0(0%)	13(68.4%)	0(0%)	5(26.3%)	0(0%)	2(10.5%)
Norfloxacin	50(56.8%)	18(20.4%)	20(22.7%)	7(14.0%)	11(55.0%)	2(4.0%)	13(65.0%)	2(4.0%)	9(45.0%)	5(1.0%)	7(35.0%)	0(0%)	2(10.0%)	0(0%)	2(1.0%)
Aztreonam	67(76.1%)	9(10.2%)	12(13.6%)	0(0%)	11(91.6%)	0(0%)	11(91.6%)	5(7.1%)	5(41.6%)	0(0%)	11(91.6%)	0(0%)	5(41.6%)	0(0%)	2(16.6%)
Tobramycin	68(77.2%)	9(10.2%)	11(12.5%)	0(0%)	11(100%)	0(0%)	11(100%)	0(0%)	11(100%)	0(0%)	11(100%)	0(0%)	3(27.2%)	0(0%)	2(18.1%)
Piperacillin	48(54.5%)	11(12.5%)	29(28.4%)	3(5.1%)	25(86.2%)	3(5.1%)	14(48.2%)	2(3.4%)	6(20.6%)	2(3.4%)	8(27.5%)	0(0%)	2(6.8%)	0(0%)	2(6.8%)
Piperacillin/tazobactam	48(54.4%)	16(18.1%)	24(27.2%)	2(4.1%)	19(79.1%)	3(6.2%)	11(45.8%)	3(6.2%)	7(29.1%)	3(6.2%)	6(25.0%)	0(0%)	2(8.3%)	0(0%)	2(8.3%)
MDR	37(22.4%)			35(94.5%)		17(45.9%)		12(32.4%)		12(32.4%)		5(13.5%)		2(5.4%)
β-lactamase-producer strain
class A β-lactamases (ESBL)	43(22.4%)			39(90.6%)		20(46.5%)		10(23.2%)		8(18.6%)		5(11.6%)		2(4.6%)
class B β-lactamases (MBL)	7(22.4%)			5(71.4%)		5(71.4%)		7(100%)		7(100%)		5(71.4%)		2(28.5%)
class D β-lactamases (KPC)	11 (12.5%) (Hodge test)19 (21.5%) (Carba-NP)			11 (100%)17 (89.7%)		10 (90.9%)14 (73.6%)		11 (100%)12 (63.1%)		11 (100%)9 (47.3%)		5 (45.4%)4 (21.0%)		2 (18.1%)2 (10.5%)
Clinical isolates
Wound	26(29.5%)			17(65.3%)		14(53.8%)		8(30.6%)		11(42.3%)		11(42.3%)		2(7.6%)
Blood	19(21.5%)			13(68.4%)		5(26.3%)		2(10.5%)		2(10.5%)		2(10.5%)		0(0%)
Urine	10(11.3%)			5(50.0%)		1(1.0%)		1(1.0%)		1(0%)		1(0%)		0(0%)
Catheter	11(12.5%)			3(27.2%)		0(0%)		0(0%)		0(0%)		0(0%)		0(0%)
Other case	22(25%)			0(0%)		0(0%)		0(0%)		0(0%)		0(0%)		0(0%)

Figure 1 ai: The result of phenotypic detection of ESBL-producing Pseudomonas aeruginosa by Double-Disk Confirmatory Test (DDCT) in Pseudomonas aeruginosa. A: Ceftazidime (30 µg); B: ceftazidime + clavulanate (30/10µg); C: cefotaxime + clavulanate (30/10µg); D: cefotaxime (30 µg). Top: ESBL negative strain; Bottom: ESBL positive strain; ESBL positive isolates show an increase of 5 mm zone of inhibition with clavulanic acid as compared to the zone size for CTX and CZD alone. aii: The result of phenotypic detection of MBL-producing Pseudomonas aeruginosa by EDTA-imipenem microbiological (EIM) test in Pseudomonas aeruginosa. A: EDTA + imipenem; B: imipenem. Top: MBL positive strain; Bottom: MBL negative strain; MBL considered positive when zone diameter difference between imipenem + EDTA and imipenem discs was larger than 7 mm.

Figure 2 The result of phenotypic detection of carbapenemase-producing Pseudomonas aeruginosa by Modified Hodge test (right) and Carba-NP test test (left) in Pseudomonas aeruginosa. ai A: control negative strain; B: KPC negative strain by Carba-NP test test; C: KPC positive strain by Carba-NP test test. aii D: KPC positive strain by Modified Hodge test; (E) KPC negative strain by Modified Hodge test.

Figure 3 Phylogenetic tree of β-lactamases genes based on the gene sequencing of the class A and class B β-lactamases in P. aeruginosa isolates.

Abbreviations: MDR, multidrug-resistant; Com, chromosomal genes; Pls, plasmid genes; CAZ, ceftazidime; DOR, doripenem; MER, meropenem; IMI, imipenem; CPE, cefepime; GEN, gentamycin; CIP, ciprofloxacin; AK, amikacin; NOR, norfloxacin; AZT, aztreonam; TOB, tobramycin; PIP, piperacillin; PI/TA, piperacillin/tazobactam.

Figure 4 Analytical sensitivity of Real-time PCR for primers used to detect class B β-lactamases genes in clinical isolates of P. aeruginosa. ai to aiii: bla_GES; ai: Melting curve in 86.86°C; aii: Amplification curve; and aiii: Standard curve with efficiency=1.808. bi to biii: bla_IMP gene; bi: Melting curve in 80.16°C; bii: Amplification curve; and biii: Standard curve with efficiency=1.742. ci to ciii: bla_VIM gene; ci: Melting curve in 84.84°C; cii: Amplification curve; and ciii: Standard curve with efficiency=1.575. The mean of a: 10⁸; b: 10⁷; c: 10⁶; d: 10⁵; e: 10⁴; f: 10³; g: 10²; h: 10¹ and i: 10° CFU/mL of DNA dilutions. Horizontal lines represent cycle threshold of Real-time PCR. One peak with a shoulder corresponds to genomic DNA amplification; no peak corresponds to no amplification. SYBR Green I Dye and single-tube reaction were used in this test. Also, Real-Time PCR was performed as single-step.

Figure 5 Analytical sensitivity of real-time PCR for primers used to detect class A β-lactamases genes in clinical isolates of P. aeruginosa. ai to aiii: bla_TEM gene; ai: Melting curve in 82.4°C; aii: Amplification curve; and aiii: Standard curve with efficiency=1.429. bi to biii: bla_SHV gene; bi: Melting curve in 88.52°C; bii: Amplification curve; and biii: Standard curve with efficiency=1.742. ci to ciii: bla_KPC gene; ci: Melting curve in 83.55°C; cii: Amplification curve; and ciii: Standard curve with efficiency=1.575. The mean of a: 10⁸; b: 10⁷; c: 10⁶; d: 10⁵; e: 10⁴; f: 10³; g: 10²; h: 10¹ and i: 10° CFU/mL of DNA dilutions. Horizontal lines represent cycle threshold of Real-time PCR. One peak with a shoulder corresponds to genomic DNA amplification; no peak corresponds to no amplification. SYBR Green I Dye and single-tube reaction were used in this test. Also, Real-Time PCR was performed as single-step.

Figure 6 The result of molecular detection of class A β-lactamases genes by HRMA assay. a: bla_SHV with 245 bp length and a melting temperature of 88.57±0/5°C; b: bla_TEM with 101 bp length and a melting temperature of 82.4±0/5°C; c: bla_KPC with 245 bp length and a melting temperature of 83.55±0/5°C. β-lactamases producing genes were amplified successfully using the EvaGreen Dye in the ABI Step-OnePlus machine by one-sept protocol. Primers specific melting peaks were obtained via HRMA analysis, allowing the differentiation of all investigated β-lactamase enzymes. Due to the highly saturating EvaGreen dye and the HRMA analysis, the accuracy of the resolution was ±0. 1–0.5 °C. (ai, bi, and ci) Melting curves; (aii, bii, and cii) normalized plot; and (aiii, biii, and ciii) difference plot.

Figure 7 The result of molecular detection of class B β-lactamases genes by HRMA assay. a: bla_GES with 72 bp length and a melting temperature of 86.86±0/5°C; b: bla_IMP with 114 bp length and a melting temperature of 80.16±0/5°C; c: bla_VIM with 105 bp length and a melting temperature of 84.80±0/5°C. β-lactamases producing genes were amplified successfully using the EvaGreen Dye in the ABI Step-OnePlus machine. Primers specific melting peaks were obtained via HRMA analysis, allowing the differentiation of all investigated β-lactamase enzymes. Due to the highly saturating EvaGreen dye and the HRMA analysis, the accuracy of the resolution was ±0. 1–0.5 °C. (ai, bi, and ci) Melting curves; (aii, bii, and cii) normalized plot; and (aiii, biii, and ciii) difference plot.

Table 3 Sensitivities, Specificities, Positive Predictive and Negative Predictive Values for Phenotypic and HRMA (bla_SHV Gene for ESBL-Producing, bla_KPC Gene for Carbapenemase-Producing and bla_VIM Gene for MBL-Producing) Methods in β-Lactamase-Producing Strain of P. aeruginosa

Methods	No. of P. aeruginosa Strains (Total n = 88)
	KPC Strains (Total n = 12)				MBL Strains (Total n = 5)				ESBL Strains (Total n = 39)				Sen (%)	Sp (%)	PPV (%)	NPV (%)
	True Positive	False Positive	False Negative	True Negative	True Positive	False Positive	False Negative	True Negative	True Positive	False Positive	False Negative	True Negative
DDT	0	0	0	0	0	0	0	0	43	4	2	86	95.55	95.55	91.48	97.72
EIM assay	0	0	0	0	7	2	2	81	0	0	0	0	77.77	97.59	97.59	77.77
Hodge test	11	1	1	76	0	0	0	0	0	0	0	0	91.66	98.70	91.66	98.70
Carba-NP	19	4	2	74	0	0	0	0	0	0	0	0	90.47	94.87	97.36	82.60
HRM	12	0	0	76	5	0	0	83	39	0	0	69	100	100	100	100
Gold Standard	12	0	0	76	5	0	0	83	39	0	0	69	100	100	100	100

Abbreviations: Sen, sensitivity; Sp, speciation; PPV, positive predictive values; NPV, negative predictive values.

Table 4 Sensitivities, Specificities, Positive Predictive and Negative Predictive Values for Phenotypic and HRMA (bla_TEM Gene for ESBL-Producing, bla_IMP Gene for Carbapenemase-Producing and bla_GES Gene for MBL-Producing) Methods in β-Lactamase-Producing Strain of P. aeruginosa

Methods	No. of P. aeruginosa Strains (Total n = 88)
	MBL Strains (Total n = 13)				KPC Strains (Total n = 2)				ESBL Strains (Total n = 20)				Sen (%)	Sp (%)	PPV (%)	NPV (%)
	True Positive	False Positive	False Negative	True Negative	True Positive	False Positive	False Negative	True Negative	True Positive	False Positive	False Negative	True Negative
DDT	0	0	0	0	0	0	0	0	43	16	7	81	86	83.50	72.88	92.04
EIM assay	7	3	2	81	0	0	0	0	0	0	0	0	77.77	96.42	70	91.01
Hodge test	0	0	0	0	11	2	1	76	0	0	0	0	91.66	97.43	84.61	98.70
Carba-NP	0	0	0	0	19	4	3	73	0	0	0	0	83.36	94.80	82.60	96.05
HRM	2	0	0	85	13	0	0	76	20	0	0	68	100	100	100	100
Gold Standard	2	0	0	85	13	0	0	76	20	0	0	68	100	100	100	100

Abbreviations: Sen, sensitivity; Sp, speciation; PPV, positive predictive values; NPV, negative predictive values.

Table 5 Relationship of Antibiotic Susceptibility Profiles, β-Lactamase Class and Sensitivity/Specificity of Phenotypic and HRMA in Clinical Isolates of P. aeruginosa

Antibiotics Resistance	Methods
	DDT	EIM	Hodge test	Carba-NP	HRMA	Gold Standard
Ceftazidime	0.071	0.040	0.832	0.097	0.033	0.077
Doripenem	0.097	0.020	0.065	0.009	0.832	0.089
Meropenem	0.193	0.080	0.073	0.043	0.193	0.193
Imipenem	0.169	0.061	0.340	0.032	0.169	0.169
Cefepime	0.071	0.040	0.832	0.097	0.033	0.056
Gentamycin	0.097	0.020	0.065	0.009	0.832	0.117
Ciprofloxacin	0.193	0.080	0.073	0.043	0.193	0.146
Amikacin	0.169	0.061	0.340	0.032	0.169	0.088
Norfloxacin	0.071	0.040	0.832	0.097	0.033	0.077
Aztreonam	0.097	0.020	0.065	0.009	0.832	0.089
Tobramycin	0.193	0.080	0.073	0.043	0.193	0.193
Piperacillin	0.169	0.061	0.340	0.032	0.169	0.169
Piperacillin/tazobactam	0.071	0.040	0.832	0.097	0.033	0.056
MDR	0.218	0.824	0.343	0.383	0.647	0.052
β-lactamase-producer strain
class A β-lactamases (ESBL)	0.077	0.252	0.005	0.050	0.027	0.079
class B β-lactamases (MBL)	0.089	0.085	0.063	0.006	0.045	0.035
class A β-lactamases (KPC)	0.193	0.080	0.073	0.043	0.025	0.044

Roschanski N, Fischer J, Guerra B, Roesler U. Development of a Multiplex real-time PCR for the Rapid Detection of the Predominant Beta-Lactamase Genes CTX-M, SHV, TEM and CIT-Type AmpCs in Enterobacteriaceae. PLoS One. 2014;9(7):e100956. doi:10.1371/journal.pone.0100956.25033234

 PubMed Web of Science ®Google Scholar

Tahmasebi H, Dehbashi S, Arabestani MR. High resolution melting curve analysis method for detecting of carbapenemases producing pseudomonas aeruginosa. JKIMSU. 2018;7(4):70–77.

 Google Scholar

Kosykowska E, Dzieciątkowski T, Mlynarczyk G. Rapid Detection of NDM, VIM, KPC and IMP Carbapenemases by real-time PCR. J Bacteriol Parasitol. 2016;07(06). doi:10.4172/2155-9597.1000299.

 Google Scholar