Treatment Failure in Urinary Tract Infections: A Warning Witness for Virulent Multi-Drug Resistant ESBL- Producing Escherichia coli

Figures & data

Table 1 List of Primers, Expected Amplicon Size, and the PCR Conditions

Genes	Primer Sequences (5′ to 3′)	Amplicon Size (bp)	PCR Conditions	References
β-lactamase genes
blaCTX-M	F: accgccgataattcgcagat R: gatatcgttggtggtgccata	588	1 cycle of 94°C for 5 min; 32 cycles of 94°C for 30 s, 54°C for 1 min, 72°C for 2 min; 1 cycle of 72°C for 5 min	[^Citation11]
blaSHV	F: cactcaaggatgtattgtg R: ttagcgttgccagtgctcg	885	1 cycle of 94°C for 5 min; 30 cycles of 94°C for 1 min, 50.5°C for 1 min, 72°C for 1 min; 1 cycle of 72°C for 6 min	[^Citation12]
blaTEM	F: ttcttgaagacgaaagggc R: acgctcagtggaacgaaaac	1150	1 cycle of 94°C for 5 min; 30 cycles of 94°C for 1 min, 53°C for 45 s, 72°C for 1 min; 1 cycle of 72°C for 7 min	[^Citation12]
Virulence genes
fimH	F: tcgagaacggataagccgtgg R: gcagtcacctgccctccggta	508	1 cycle of 95°C for 5 min; 30 cycles of 94°C for 30 s, 62°C for 30 s, 68°C for 3 min; 1 cycle of 72°C for 10 min	[^Citation13]
papA	F: atggcagtggtgttttggtg R: cgtcccaccatacgtgctcttc	717	Same as for fimH	[^Citation13]
malX	F: ggacatcctgttacagcgcgca R: tcgccaccaatcacagccgaac	925	Same as for fimH	[^Citation13]
papC	F:gacggctgtactgcagggtgtggcg R: atatcctttctgcagggatgcaata	328	1 cycle of 94°C for 5 min; 30 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min; 1 cycle of 72°C for 10 min	[^Citation14]
afa	F:gctgggcagcaaactgataactctc R: catcaagctgtttgttcgtccgccg	750	Same as for papC	[^Citation14]
csgA	F: actctgacttgactattacc R: agatgcagtctggtcaac	200	Same as for papC	[^Citation15]
tsh	F: gggaaatgacctgaatgctgg R: ccgctcatcagtcagtaccac	420	1 cycle of 95°C for 5 min; 30 cycles of 94°C for 30 s, 62°C for 45 s, 72°C for 90 s; 1 cycle of 72°C for 10 min	[^Citation15]
hlyD	F: ctccggtacgtgaaaaggac R: gccctgattactgaagcctg	904	Same as for tsh	[^Citation13]
ibeA	F: aggcaggtgtgcgccgcgtac R: tggtgctccggcaaaccatgc	171	Same as for tsh	[^Citation13]
sitA	F: agggggcacaactgattctcg R: taccgggccgttttctgtgc	608	Same as for tsh	[^Citation13]
iss	F: gtggcgaaaactagtaaaacagc R: cgcctcggggtggataa	760	1 cycle of 94°C for 4 min; 30 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1 min; 1 cycle of 72°C for 5 min	[^Citation16]

Table 2 Prevalence of the Antimicrobial Resistance Among the UPEC Isolates^a

Antibiotics	Resistance in	Resistance in		Resistance in		Resistance in		Resistance in
	All Isolates (n=78)	MDR Isolates (n=73)	Non-MDR Isolates (n=5)	ESBL Producers (n=27)	Non-ESBL Producers (n=51)	Females’ Isolates (n=53)	Males’ Isolates (n=25)	blaCTX-M Positive Isolates (n=29)	blaSHV Positive Isolates (n=37)	blaTEM Positive Isolates (n=12)
β- lactam antibiotics (penicillins)
Penicillin	78 (100)	73 (100)	5 (100)	27 (100)	51 (100)	53 (100)	25 (100)	29 (100)	37 (100)	12 (100)
Ampicillin	78 (100)	73 (100)	5 (100)	27 (100)	51 (100)	53 (100)	25 (100)	29 (100)	37 (100)	12 (100)
Amoxicillin	78 (100)	73 (100)	5 (100)	27 (100)	51 (100)	53 (100)	25 (100)	29 (100)	37 (100)	12 (100)
β- lactam antibiotics (first generation cephalosporins)
Cephalexin	44 (56.4)	43 (58.9)	1 (20.0)	23 (85.2)	21 (41.2)	26 (49.1)	18(72.0)	25 (86.2)	23 (62.2)	8 (66.7)
β- lactam antibiotics (third generation cephalosporins)
Cefixime	43 (55.1)	42 (57.5)	1 (20.0)	24 (88.9)	19 (37.3)	25 (47.2)	18 (72.0)	26 (89.7)	24 (64.9)	7 (58.3)
Ceftriaxone	42 (53.8)	41 (56.2)	1 (20.0)	26 (96.3)	16 (31.4)	24 (45.3)	18 (72.0)	28 (96.6)	22 (59.5)	7 (58.3)
Ceftazidime	34 (43.6)	34 (46.6)	0 (0.0)	20 (74.1)	14 (27.5)	17 (32.1)	17 (68.0)	21 (72.4)	18 (48.6)	6 (50.0)
Cefotaxime	43 (55.1)	42 (57.5)	1 (20.0)	27 (100)	16 (31.4)	25 (47.2)	18 (72.0)	29 (100)	24 (64.9)	6 (50.0)
Aminoglycosides
Gentamicin	13 (16.7)	12 (16.4)	1 (20.0)	7 (25.9)	6 (11.8)	4 (7.5)	9 (36.0)	8 (27.6)	5 (13.5)	3 (25.0)
Amikacin	17 (21.8)	17 (23.3)	0 (0.0)	8 (29.6)	9 (17.6)	11 (20.8)	6 (24.0)	8 (27.6)	7 (18.9)	4 (33.3)
Fluoroquinolones
Ciprofloxacin	47 (60.3)	47 (64.4)	0 (0.0)	21 (77.8)	26 (51.0)	28 (52.8)	19 (76.0)	23 (79.3)	22 (59.5)	7 (58.3)
Levofloxacin	44 (56.4)	44 (60.3)	0 (0.0)	20 (74.1)	24 (47.1)	25 (47.2)	19 (76.0)	22 (75.9)	21 (56.8)	7 (58.3)
Dihydrofolate reductase inhibitors
Trimethoprim- Sulfamethoxazole	50 (64.1)	49 (67.1)	1(20.0)	22 (81.5)	28 (54.9)	31(58.5)	19 (76.0)	24 (82.8)	26 (70.3)	9 (75.0)
Nitrofurans
Nitrofurantoin	18 (23.1)	18 (24.7)	0 (0.0)	5 (18.5)	13 (25.5)	11 (20.8)	7 (28.0)	6 (20.7)	6 (16.2)	1 (8.3)
Tetracyclines
Tetracycline	49 (62.8)	49 (67.1)	0 (0.0)	21 (77.8)	28 (54.9)	29 (54.7)	20 (80.0)	22 (75.9)	24 (64.9)	8 (66.7)

Note: ^aValues were showed as No. (%). The highest and lowest amounts in each column are emboldened.

Table 3 Resistance and Virulence Scores Among the UPEC Isolates^a

Scores	In	In		In		In		In		In		In
	All Isolates (n=78)	MDR Isolates (n=73)	Non-MDR Isolates (n=5)	ESBL Producers (n=27)	Non-ESBL Producers (n=51)	Females’ Isolates (n=53)	Males’ Isolates (n=25)	blaCTX-M Positive Isolates (n=29)	blaCTX-M Negative Isolates (n=49)	blaSHV Positive Isolates (n=37)	blaSHV Negative Isolates (n=41)	blaTEM Positive Isolates (n=12)	blaTEM negative isolates (n=66)
Resistance score
Range	3–15	3–15	3–7	4–15	3–14	3–14	3–15	4–15	3–14	3–15	3–15	4–14	3–15
Mean	8.7	9.0	4.2	11.3	7.3	7.8	10.5	11.3	7.1	9.0	8.4	9.1	8.6
Median	8.5	9.0	4.0	12.0	7.0	7.0	12.0	12.0	6.0	9.0	7.0	9.0	8.5
Virulence score
Range	1–10	1–9	5–10	1–7	1–10	1–9	1–10	1–7	1–10	1–9	1–10	1–6	1–10
Mean	4.5	4.3	7.2	4.4	4.5	4.5	4.4	4.4	4.5	4.4	4.5	3.8	4.6
Median	4.5	4.0	6.0	5.0	4.0	4.0	5.0	5.0	4.0	5.0	4.0	4.5	4.5

Note: ^aThe highest and lowest amounts in each row are emboldened.

Table 4 Prevalence of the Virulence Genes Among the UPEC Isolates^a

Virulence Gene	Prevalence in	Prevalence in		Prevalence in		Prevalence in		Prevalence in
	All Isolates (n=78)	MDR Isolates (n=73)	Non-MDR Isolates (n=5)	ESBL Producers (n=27)	Non-ESBL Producers (n=51)	Females’ Isolates (n=53)	Males’ Isolates (n=25)	blaCTX-M Positive Isolates (n=29)	blaSHV Positive Isolates (n=37)	blaTEM Positive Isolates (n=12)
Adhesin
fimH	57 (73.1)	52 (71.2)	5 (100)	18 (66.7)	39 (76.5)	41 (77.4)	16 (64.0)	20 (69.0)	27 (73.0)	9 (75.0)
papA	27 (34.6)	24 (32.9)	3 (60.0)	10 (37.0)	17 (33.3)	19 (35.8)	8 (32.0)	12 (41.4)	17 (45.9)	2 (16.7)
papC	35 (44.9)	32 (43.8)	3 (60.0)	16 (59.3)	19 (37.3)	23 (43.4)	12 (48.0)	16 (55.2)	15 (40.5)	3 (25.0)
csgA	64 (82.1)	60 (82.2)	4 (80.0)	23 (85.2)	41 (80.4)	40 (75.5)	24 (96.0)	25 (86.2)	29 (78.4)	9 (75.0)
afa	11 (14.1)	10 (13.7)	1 (20.0)	4 (14.8)	7 (13.7)	8 (15.1)	3 (12.0)	4 (13.8)	4 (10.8)	1 (8.3)
tsh	28 (35.9)	24 (32.9)	4 (80.0)	8 (29.6)	20 (39.2)	20 (37.7)	8 (32.0)	8 (27.6)	14 (37.8)	3 (25.0)
Toxin
hlyD	19 (24.4)	15 (20.5)	4 (80.0)	6 (22.2)	13 (25.5)	12 (22.6)	7 (28.0)	7 (24.1)	7 (18.9)	2 (16.7)
Invasin
ibeA	11 (14.1)	8 (11.0)	3 (60.0)	1 (3.7)	10 (19.6)	7 (13.2)	4 (16.0)	1 (3.4)	3 (8.1)	4 (33.3)
Protectin
iss	18 (23.1)	16 (21.9)	2 (40.0)	4 (14.8)	14 (27.5)	10 (18.9)	8 (32.0)	4 (13.8)	7 (18.9)	0 (0.0)
Siderophore
sitA	57 (73.1)	52 (71.2)	5 (100)	19 (70.4)	38 (74.5)	43 (81.1)	14 (56.0)	21 (72.4)	29 (78.4)	10 (83.3)
Miscellaneous
malX	21 (26.9)	19 (26.0)	2 (40.0)	9 (33.3)	12 (23.5)	16 (30.2)	5 (20.0)	10 (34.5)	10 (27.0)	2 (16.7)

Note: ^aValues were showed as No. (%). The highest and lowest amounts in each column are emboldened.

Tabar MM, Mirkalantari S, Amoli RI. Detection of ctx-M gene in ESBL-producing E. coli strains isolated from urinary tract infection in Semnan, Iran. Electron Physician. 2016;8(7):2686–2690. doi:10.19082/268627648198

 PubMedGoogle Scholar

Brinas L, Zarazaga M, Saenz Y, et al. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob Agents Chemother. 2002;46(10):3156–3163. doi:10.1128/AAC.46.10.3156-3163.200212234838

 PubMed Web of Science ®Google Scholar

Rodriguez-Siek KE, Giddings CW, Doetkott C, et al. Comparison of Escherichia coli isolates implicated in human urinary tract infection and avian colibacillosis. Microbiology. 2005;151(Pt 6):2097–2110. doi:10.1099/mic.0.27499-015942016

 PubMed Web of Science ®Google Scholar

Le Bouguenec C, Archambaud M, Labigne A. Rapid and specific detection of the pap, afa, and sfa adhesin-encoding operons in uropathogenic Escherichia coli strains by polymerase chain reaction. J Clin Microbiol. 1992;30(5):1189–1193. doi:10.1128/JCM.30.5.1189-1193.19921349900

 PubMed Web of Science ®Google Scholar

Maurer JJ, Brown TP, Steffens WL, et al. The occurrence of ambient temperature-regulated adhesins, curli, and the temperature-sensitive hemagglutinin tsh among avian Escherichia coli. Avian Dis. 1998;42(1):106–118. doi:10.2307/15925829533087

 PubMed Web of Science ®Google Scholar

Horne SM, Pfaff-McDonough SJ, Giddings CW, et al. Cloning and sequencing of the iss gene from a virulent avian Escherichia coli. Avian Dis. 2000;44(1):179–184. doi:10.2307/159252210737659

 PubMed Web of Science ®Google Scholar