Pyrazinamide Resistance and Mutation Patterns Among Multidrug-Resistant Mycobacterium tuberculosis from Henan Province

Figures & data

Table 1 PZA Resistance in Different Groups of MDR-TB Patients

Characteristics	No. of Isolates (n=152)	No. of PZA Resistant Isolates (n=105)	No. of PZA Susceptible Isolates (n=47)	OR	95% CI	P value
Age
<20	28	18	10	0.77	0.32–1.85	0.65
21–40	39	26	13	0.86	0.39–1.87	0.69
41–60	61	45	16	1.43	0.71–2.97	0.32
>60	24	16	8	0.88	0.34–2.22	0.81
Sex
Female	51	28	23	1.00 (reference)
Male	101	77	24	2.64	1.29–5.40	0.01
Treatment History
New case	43	20	23	1.00 (reference)
Retreated	109	85	24	4.07	1.92–8.63	<0.001
Drug resistance to			0
Ethambutol	85	66	19	2.45	1.23–5.04	0.01
Streptomycin	119	90	29	3.724	1.67–8.31	<0.001
Kanamycin	35	25	10	1.156	0.50–2.65	0.84
Levofloxacin	63	53	10	2.39	1.17–4.89	0.02
Capreomycin	25	17	8	0.942	0.37–2.37	1
P-aminsalicylic acid	15	13	2	3.179	0.69–14.70	0.15
Protionamide	23	16	7	1.027	0.39–2.69	1
Amikacin	35	23	12	0.82	0.37–1.83	0.68
All four first-line drug resistant	109	82	27	2.64	1.26–5.54	0.01
Pre-extensive-drug resistant^a	53	43	10	2.57	1.15–5.71	0.02
Extensive-drug resistant^b	27	25	2	7.03	1.59–31.07	<0.001
Spoligotyping
Beijing family	127	97	30	6.87	2.70–17.50	<0.001
T family^c	10	6	4	0.652	1.07–2.42	0.49
Other family	14	2 ^d	12 ^e	0.057	0.01–0.27	<0.001
NTF type
Ancestral type	34	12	22	1.00(reference)
Modern type	118	93	25	6.82	2.97–15.45	<0.001

Notes: ^aPre-XDR strains: MDR strains that were also resistant to levofloxacin or any injectable drug (kanamycin, capreomycin, amikacin). ^bXDR strains: MDR strains that were also resistant to levofloxacin and any injectable drug (kanamycin, capreomycin, amikacin). ^cIncluding the T1, T2, and T3 genotypes. ^dTwo strains in the MANU2 family. ^eSeven strains in the MANU2 family, four in the H3 family, and one with an unknown genotype.

Table 2 Correlation between pncA Mutation Patterns and PZAResistance

		No. of PZA Susceptible	No.of PZA Resistant	Total
No mutation		39	11	50
Single mutation		5	81	86
Silent mutation		3	0	3
Multiple mutation		0	13	13
Total		47	105	152

Table 3 Mutant Profiles of MDR-TB Isolates Within pncA

	Nucleotide Position	Nucleotide Change	Amino Acid Position	Amino Acid Change	No. of Isolates
	Substitution
1	−12	T to C	Promoter	–	5
2	−11	A to G	Promoter	–	1
3	3	ATG to ATA	1	Met to Ile	1
4	11	TTG to TCG	4	Leu to Ser	1
5	14	ATC to AGC	5	Ile to Ser	1
6	19	GTC to TTC	7	Val to Phe	2
7	20	GTC to GGC	7	Val to Gly	1
8	24	GAC to GAA	8	Asp to Glu	1
9	24	GAC to GAG	8	Asp to Glu	1
10	26	GTG to GCG	9	Valto Ala	2
11	26	GTG to GGG	9	Val to Gly	1
12	28	CAG to TAG	10	Gln to Stop	1
13	29	CAG to CCG	10	Gln to Pro	1
14	35	GAC to GCC	12	Asp to Ala	2
15	35	GAC to GGC	12	Asp to Gly	1
16	37*	TTC to GTC	13	Phe to Val	1
17	40*	TGC to GGC	14	Cys to Gly	1
18	40	TGC to CGC	14	Cys to Arg	1
19	41	TGC to TAC	14	Cys to Tyr	1
20	50	GGC to GAC	17	Gly to Asp	1
21	56	CTG to CCG	19	Leu to Pro	1
22	62	GTA to GGA	21	Val to Gly	3
23	71	GGC to GAC	24	Gly to Asp	1
24	77	GCG to GGG	26	Ala to Gly	1
25	83	GCC to GAC	28	Ala to Asp	1
26	94	TTC to GTC	32	Phe to Val	1
27	104	CTG to CCG	35	Leu to Pro	1
28	105*	CTG to CTC	35	Leu to Pro	1
29	123	TAC to TAG	41	Tyr to Stop	1
30	128	CAC to CCC	43	His to Pro	1
31	136	GCA to CCA	46	Ala to Pro	1
32	145	GAC to AAC	49	Asp to Asn	1
33	146	GAC to GGC	49	Asp to Gly	1
34	146	GAC to GCC	49	Asp to Ala	1
35	152	CAC to CGC	51	His to Arg	1
36	160	CCG to TCG	54	Pro to Ser	1
37	161*	CCG to CGG	54	Pro to Arg	1
38	161	CCG to CAG	54	Pro to Glu	1
39	170*	CAC to CGC	57	His to Arg	1
40	171	CAC to CAA	57	His to Gln	1
41	172	TTC to GTC	58	Phe to Val	1
42	185	CCG to CGG	62	Pro to Arg	1
43	194*	TCC to TGC	65	Ser to Cys	1
44	196	TCG to CCG	66	Ser to Pro	1
45	202	TGG to CGG	68	Trp to Arg	1
46	203	TGG to TCG	68	Trp to Ser	1
47	203	TGG to TAG	68	Trp to Stop	2
48	212	CAT to CGT	71	His to Arg	1
49	212*	CAT to CCT	71	His to Pro	1
50	226	ACT to CCT	76	Thr to Pro	4
51	254	CTG to CGG	85	Leu to Arg	1
52	269*	ATC to ACC	90	Ile to Thr	1
53	287	AAG to AGG	96	Lys to Arg	1
54	290	GGT to GAT	97	Gly to Asp	1
55	305	GCG to GTG	102	Ala to Val	1
56	308	TAC to TGC	103	Tyr to Cys	1
57	314	GGC to GAC	105	Gly to Asp	1
58	317*	TTC to TCC	106	Phe to Ser	1
59	359	CTG to CGG	120	Leu to Arg	7
60	374	GTC to GGC	125	Val to Gly	1
61	374*	GTC to GCC	125	Val to Ala	1
62	398	ATT to ACT	133	Ile to Thr	2
63	407	GAT to GGT	136	Asp to Gly	1
64	412	TGT to CGT	138	Cys to Arg	1
65	416	GTG to GGG	139	Val to Gly	2
66	424	ACG to CCG	142	Thr to Pro	1
67	425	ACG to ATG	142	Thr to Met	1
68	437	GCG to GTG	146	Ala to Val	1
69	463	GTG to ATG	155	Val to Met	1
70	466*	CTG to TTG	154	Leu to Leu	1
71	467*	CTG to CAG	156	Leu to Gln	1
72	467	CTG to CCG	156	Leu to Pro	1
73	478	ACA to CCA	160	Thr to Pro	1
74	511	GCG to ACG	171	Ala to Thr	1
75	511	GCG toCCG	171	Ala to Arg	1
76	519*	GAG to GAA	173	Glu to Glu	1
77	535*	AGC to TGC	179	Ser to Cys	2
78	541*	GAG to TAG	181	Glu to Arg	1
79	543	GAG to GAT	181	Glu to Arg	1
80	555*	AGC to AGT	185	Ser to Ser	1
	deletion
81	79 to 92*	CTGGCCCGCGCCAT deletion	27	Frameshift	1
82	189 to 218*	CTATTCCTCGTCGTGGCCACCGCATTGCGT deletion	63	Frameshift	1
83	196 to 221*	TCGTCGTGGCCACCGCATTGCGTCAG deletion	64	Frameshift	1
84	200*	C deletion	84	Frameshift	1
85	246*	T deletion	141	Frameshift	1
86	329	A deletion	110	Frameshift	1
	insertion
87	−7*	G insertion	promoter	–	1
88	121*	ACG insertion	41	Asp insertion	1
89	130*	AG insertion	44	Frameshift	1
90	201*	GT insertion	67	Frameshift	1
91	240*	CGGA insertion	81	Frameshift	1
92	253*	C insertion	85	Frameshift	1
93	256*	G insertion	86	Frameshift	1
94	268*	T insertion	90	Frameshift	2
95	391	G insertion	131	Frameshift	1
96	392	GG insertion	131	Frameshift	1
97	411*	TG insertion	137	Frameshift	1
98	417*	AG insertion	140	Frameshift	1
99	447*	T insertion	150	Frameshift	1
100	534*	G insertion	179	Frameshift	1
Multiple mutations
1	11,478, 535,541	TTG to TCG, ACA to CCA, AGC to TGC, GAG to TAG	4,160,179,181	Leu to Ser, Thr to Pro, Ser to Cys, Glu to Arg	1
2	24,35, 254, 412	GAC to GAA, GAC to GCC, CTG to CGG, TGT to CGT	8,12,85,138	Asp to Glu, Asp to Gly, Leu to Arg, Cys to Arg	1
3	105,121, 203	CTG to CTC, ACG insertion, TGG to TCG	35,44	Leu to Pro, Aspinsertion,Trp to Ser	1
4	26,40,398	GTG to GCG, TGC to GGC, ATT to ACT	9,14,133	Val to Ala, Cys to Gly, Ile to Thr	1
5	56,145,463	CTG to CCG, GAC to AAC, GTG to ATG	19,49,155	Leu to Pro, Asp to Asn, Val to Met	1
6	19,437	GTC to TTC, GCG to GTG	71,46	Val to Phe, Ala to Val	1
7	77,171	GCG to GGG, CAC to CAA	26,57	Ala to Gly, His to Gln	1
8	40,104	TGC to CGC, CTG to CCG	14,35	Cys to Arg, Cys to Arg	1
9	37,128,	TTC to GTC, CAC to CCC	13,43	Phe to Val, His to Pro	1
10	160,253	CCG to CTG, C insertion	54,85	Pro to Ser, Frameshift	1
11	196,212	TCG to CCG, CAT to CCT	66,71	Ser to Pro, His to Pro	1
12	29,287	CAG to CCG, AAG to AGG	10,96	Gln to Pro, Lys to Arg	1
13	161,200	CCG to CGG, C deletion	54,84	Pro to Arg, Frameshift	1

Note: *Not found in the TBDRM and GMTV databases or in previous studies.

Table 4 MIC of PZA-Susceptible Strains Harbouring pncA Mutation(s)

Nucleotide Position	Nucleotide Change	Amino Acid Position	Amino Acid Change	No. of Isolates	MIC (μg/mL)
11	TTG to TCG	4	Leu to Ser	1	25
424	ACG to CCG	142	Thr to Pro	1	50
478	ACA to CCA	160	Thr to Pro	1	25
535^a	AGC to TGC	179	Ser to Cys	1	50
541	GAG to TAG	181	Glu to Arg	1	50
466^b	CTG to TTG	154	Leu to Leu	1	12.5
519^b	GAG to GAA	173	Glu to Glu	1	12.5
555^b	AGC to AGT	185	Ser to Ser	1	12.5

Notes: ^aPresent in both PZA-resistant and PZA-susceptible strains. ^bSynonymous mutation.

Table 5 Mutant Profiles of rpsA and panD among MDR-TB Isolates

	Nucleotide Position	Nucleotide Change	Amino Acid Position	Amino Acid Change	No. of Isolates	pncA Nucleotide Change(Amino Acid Change)
PZA resistant isolates
rpsA
	93^a	AAG to AAC	31	Lys to Asn	2	T20G (Val7Gly), A212G (His71Pro)
	357 ^a, b	CTC to CGC	119	Leu to Arg	1	wild-type
	368	GAC to GCC	123	Asp to Ala	1	C171A(His57Gln)
	532^a,b	AAG to GAG	178	Lys to Glu	1	wild-type
	630^a	ACC to AGC	210	Thr to Cys	1	G50A(Gly17Asp)
	636^c	CGA to CGC	212	Arg to Arg	68
	949^a	ATC to GTC	317	Ile to Val	1	C161G(Pro54Arg)
	1235	GCC to GTC	412	Ala to Val	1	G145A(Asp49Asn)
panD
	167	GTC to GCC	56	Val to Ala	1	T40G(Cys14Gly)
	389^b	GAG to GGG	130	Glu to Gly	1	wild-type
PZA susceptible isolates
rpsA	636	CGA to CGC	212	Arg to Arg	35	wild-type

Notes: ^aNew mutations. ^bNo pncA mutations. ^cAlso present in PZA-susceptible strains.

Table 6 Efficacy Evaluation of Sequencing for PZA Resistance in MDR Strains

gene	PZA Resistant (n=105)		PZA Susceptible (n=47)		Sensitivity (%) (95% CI)	Specificity (%) (95% CI)	Kappa Coefficient
	Substitutions Mutation and Indel	No Mutation and Synonymous Mutation	Substitutions Mutation and Indel	No Mutation and Synonymous Mutation
pncA	94	11	5	42	89.52 (81.64–94.39)	89.36 (76.10–96.01)	0.76
rpsA	7	98	0	47	6.67 (2.94–13.68)	100 (92.45–100.00)	0.07
panD	2	103	0	47	1.90 (0.23–6.70)	100 (92.45–100.00)	0.01
pncA/rpsA/panD	97	8	5	42	92.38 (85.54–96.65)	89.36 (76.10–96.01)	0.8

Table 7 Correlation Between Treatment Outcome and Drug Susceptibility for PZA

Treatment Outcome	PZA Suspustible		PZA Resistant		Chi-Square	p value
	Number of Patients	Percent of Patients (%) (95% CI)	Number of Patients	Percent of Patients (%) (95% CI)
Sputum conversion
Yes	42	95.45 (84.52–99.44)	93	93.93 (87.26–97.74)	0.71	1
No	2	4.54 (0.55–14.57)	6	6.06 (2.26–12.72)
Sputum conversion time
6 months after treatment	3	7.14 (1.05–19.48)	1	1.08 (0.03–5.84)	10.01	0.018
12 months after treatment	14	33.33 (19.56–49.55)	20	21.51 (13.65–31.23)
18 months after treatment	21	50 (34.19–65.81)	45	48.39 (37.89–58.98)
24 months after treatment	4	9.52 (2.65–22.62)	27	29.03 (20.08–39.36)