Genotypic Distribution and a Potential Diagnostic Assay of Multidrug-Resistant Tuberculosis in Northern Thailand

Figures & data

Table 1 The Oligonucleotide Primers Used in the RIF-RD and INH-RD Assays

Primer	Sequence (5ʹ→3ʹ)	Target (size)	Reference
The RIF-RD assay
rpoBF2	TCAAGGAGTTCTTCGGCAC	rpoB (123 bp)	This study
rpoB_R	CACGCTCACGTGACAGACC		Ong et al^Citation14
The INH-RD assay
katG-60F1	GGCTGGAAGAGCTCGTATGG	katG (124 bp)	This study
katG-60R1	CGTAGCCGTACAGGATCTCG		This study
inhA-FP	GGAAATCGCAGCCACGTTAC	inhA promoter (137 bp)	Peng et al^Citation30
inhA R1	GGTAACCAGGACTGAACGGG		Park et al^Citation31

Figure 1 The differentiation between phenotypically drug-resistant and -susceptible M. tuberculosis clinical strains by the optimized RIF-RD (A and B) and INH-RD (C and D) assays using M. tuberculosis H37Rv as the reference (blue line): the normalized melting curve (A and C) and the normalized melting peak (B and D).

Figure 2 The ROC curve of rpoB (A), katG (B), and inhA promoter (C) applied for determining the ∆T_m cutoff to detect RIF and INH resistance in M. tuberculosis isolates.

Table 2 The Distribution of the rpoB, katG, and inhA Genotypes Among 30 MDR-TB Isolates in Northern Thailand

Mutation Profiles		No. of MDR-TB Isolates	Percentage (n = 30)
The single mutation
rpoB	S531L (C>T)	15	50.00
	H526Y (C>T)	8	26.68
	H526D (G>C)	3	10.00
	D516V (A>T)	1	3.33
	S522L (C>T)	1	3.33
	H526R (A>G)	1	3.33
	ND	1	3.33
The single mutation
katG	S315T (G>C)	14	46.67
inhA	−15 (C>T)	4	13.34
	−9 (T>C)	1	3.33
	−17 (G>T)	1	3.33
The double mutation
katG/inhA	S315T (G>C)/−8 (T>G)	3	10.00
	S315T (G>C)/−15 (C>T)	1	3.33
	S315T (G>C)/−17 (G>T)	1	3.33
	ND	5	16.67

Note: ND, mutation was not detected within the sequenced nucleotide length.

Figure 3 The differentiation among various mutation profiles observed in rpoB, katG and inhA promoter by the optimized RIF-RD (A and B) and INH-RD (C and D) assays using M. tuberculosis H37Rv as the reference (blue line): the normalized melting curve (A and C) and the normalized melting peak (B and D).

Ong DCT, Yam WC, Siu GKH, Lee ASG. Rapid detection of rifampicin- and isoniazid-resistant Mycobacterium tuberculosis by high-resolution melting analysis. J Clin Microbiol. 2010;48(4):1047–1054. doi:10.1128/JCM.02036-0920164280

 PubMed Web of Science ®Google Scholar

Peng J, Yu X, Cui Z, et al. Multi-fluorescence real-time PCR assay for detection of RIF and INH resistance of M. tuberculosis. Front Microbiol. 2016;7:618. doi:10.3389/fmicb.2016.0061827199947

 PubMed Web of Science ®Google Scholar

Park H, Song EJ, Song ES, et al. Comparison of a conventional antimicrobial susceptibility assay to an oligonucleotide chip system for detection of drug resistance in Mycobacterium tuberculosis isolates. J Clin Microbiol. 2006;44(5):1619–1624. doi:10.1128/JCM.44.5.1619-1624.200616672384

 PubMed Web of Science ®Google Scholar