Investigating the Effect of Nano-Curcumin on the Expression of Biofilm Regulatory Genes of Pseudomonas aeruginosa

Figures & data

Table 1 Sequences of Primers and PCR Conditions of Evaluating Genes

Target	Primer (5ʹ to 3ʹ)	Amplicon Sizes	PCR Thermal Conditions
tufB	F: GTGAGAACGTTGGTATCCTG R: GTGGTACGGAAGTAGAACTG	193 bp	{95 ºC (20 Sec), 60 ºC (15 Sec), 72 ºC (20 Sec)}×35
gacA	F: AGGTGCAGCGTGATTAAG R: GCATCTTCACGTCCATCAG	181 bp	{95 ºC (20 Sec), 57 ºC (15 Sec), 72 ºC (20 Sec)}×35
retS	F: TCCCTATTTCCGCCAGAC R: CCAGCTTGACCACGATTG	143 bp	{95 ºC (20 Sec), 58 ºC (15 Sec), 72 ºC (20 Sec)}×35
lasR	F: TGGATGCTCAAGGACTACG R: TTCACATTGGCTTCCGAG	173 bp	{95 ºC (20 Sec), 56 ºC (15 Sec), 72 ºC (20 Sec)}×35
rhlR	F: CTGGAAAAGGAAGTGCGG R: GTAGTTCTGCATCTGGTATCG	141 bp	{95 ºC (20 Sec), 58 ºC (15 Sec), 72 ºC (20 Sec)}×35

Table 2 OD Values and Biofilm Formation Level of P. aeruginosa ATCC 10145 Strain in 570 nm

OD of Positive Control	OD of Negative Control	Ratios	Biofilm Level
0.79	0.15	5.26	3+ (strong)
0.83	0.19	4.36	3+ (strong)
0.61	0.23	2.65	2+ (Moderate)
0.74	0.17	4.35	3+ (strong)
0.67	0.16	4.18	3+ (strong)
Mean: 0.73	Mean: 0.18	Mean: 4.16	Total: 3+ (strong)

Table 3 Bacterial Growth in the Absence and the Presence of Different Concentrations of Nano-Curcumin According to OD Values of 600 nm After 48 Hours

Culture Conditions	BHI+10% DMSO	Nano-Curcumin Concentrations
		BHI+10% DMSO+ 25µg/mL	BHI+10% DMSO+ 20µg/mL	BHI+10% DMSO+ 15µg/mL
OD values	0.71	0.69	0.76	0.68
	0.73	0.63	0.67	0.63
	0.65	0.59	0.69	0.75
	0.69	0.61	0.63	0.66
	0.69	0.68	0.70	0.65
Mean	0.69	0.64	0.69	0.67

Figure 1 Nano-Curcumin inhibits the Biofilm in a concentration-dependent manner. The biofilm formation was reduced to 2+, 1+ and negative in 15, 20 and 25 µg/mL concentrations of Nano-Curcumin.

Figure 2 Inhibition of biofilm formation in P. aeruginosa 10145 in the absence and presence of 15, 20, and 25 µg/mL Nano-Curcumin. (***P value < 0.001). The error bar represents SD in five repeated experiments.

Figure 3 The expression level of genes involved in the regulation of biofilm in P. aeruginosa in planktonic phase, biofilm formation condition in the absence and presence of Nano-Curcumin; expression of gacA, lasR and rhlR genes increased by between 10 to 14 times in bacteria in biofilm conditions in the absence and presence of Nano-Curcumin compared to fresh planktonic bacteria. The retS gene showed no changes in the expression under biofilm conditions compared to the bacterial planktonic phase.