Prevalence of HIV-1 Integrase Strand Transfer Inhibitor Resistance in Treatment-Naïve Voluntary Counselling and Testing Clients by Population Sequencing and Illumina Next-Generation Sequencing in Taiwan

Figures & data

Table 1 Primer List for Next-Generation Sequencing Studies

Name	Sequence	Amplicon Length	Index Amplicon Length
S5-Ada-33bp-IntMF1-472bp-F-v3	TCGTCGGCAGCGTCA (S5)-GATGTGTATAAGAGACAG-(Adaptor) RCTAAAAGGRGAAGCYATRCATGG-(Int MF1-F)	472bp	542bp
N7-Ada-34bp-IntMF1-472bp-R-v2	GTCTCGTGGGCTCGGA (N7)-GATGTGTATAAGAGACAG-(Adaptor) GCCATTYGTACTGCTGTCTTAAGGT(IntMF1-R)	472bp	542bp
S5-Ada-33bp-IntMF2-475bp-F-v2	TCGTCGGCAGCGTCA(S5)- GATGTGTATAAGAGACAG-(Adaptor) ATTCCYTACAATCCCCAAAG-(IntMF2-F)	475bp	545bp
N7-Ada-34bp-IntMF2-475bp-R-v2	GTCTCGTGGGCTCGGA(N7)- GATGTGTATAAGAGACAG-(Adaptor) TCCTGTCTACTTGCCACACAATC–(IntMF2-R)	475bp	545bp

Notes: The nested PCR was conducted by the first-round PCR with 2 pairs of primers sets list above with PCR products 472 and 475bp respectively, to include the 864 bp integrase region, then the 2nd index PCR was done by adding total 69 bp overhang to the S5 and N7 primer with PCR products of 542 and 545 bp, respectively. S5-01 (37 bp overhang) AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT AGA TCG C-TC GTC GGC AGC GTCA-(S5) N7-01 (32 bp overhang) CAA GCA GAA GAC GGC ATA CGA GAT TCG CCT TA-G TCT CGT GGG CTC GGA-(N7).

Table 2 Demographic Data of the Treatment-Naïve HIV-1-Infected Patients (n=224)

Parameter		Patient Number (%)
Gender	Male	224 (100)
	Female	0 (0)
Age (years)	Median (IQR)	26 (23–31)
Age cut-off point (years)	<35	190 (85)
	≥35	34 (15)
Risk factor	Heterosexual	7 (3)
	MSM	217 (97)
Any class resistance (n=218)	Yes	18 (8)
	No	200 (92)
HIV subtype (n=218)	Non-B	8 (4)
	B	210 (96)
CD4 (cell/ul)	Minimum	7
	Maximum	1098
	Median (IQR)	305 (207–429)
CD4 cut-off point (cell/ul) (n=223)	<200	50 (22)
	≥200	173 (78)
Viral load (Log)	Minimum	2.6
	Maximum	7.0
	Median (IQR)	4.8 (4.4–5.1)
Viral load cut-off point (Log) (n=223)	< 4	16 (7)
	≥ 4	207 (93)
Syphilis (n=223)	Negative	151 (68)
	Positive	72 (32)
IHA-AMEBIASIS (n=202)	≦128	197 (98)
	≧256	5 (2)
TOXOPLASMA-IgG (n=223)	Negative	207 (93)
	Positive	16 (7)
CMV-IgG (n=222)	Negative	4 (2)
	Positive	218 (98)
CRYPTOCOCCUS Ag (n=223)	Negative	222 (99.6)
	Positive	1 (0.4)
HAV Ab (n=223)	Negative	199 (89)
	Positive	24 (11)
HBs Ab (n=223)	Negative	117 (52)
	Positive	106 (48)
HBs Ag (n=223)	Negative	204 (92)
	Positive	19 (8)
HBc Ab (n=223)	Negative	170 (76)
	Positive	53 (24)
HCV Ab (n=223)	Negative	219 (98)
	Positive	4 (2)

Abbreviations: IQR, interquartile range; HAV Ab, hepatitis A antibody; HBs Ab, hepatitis B surface antibody; HBs Ag, hepatitis B surface antigen; HBc Ab, hepatitis B core antibody; HCV Ab, hepatitis C virus antibody; IHA, indirect hemagglutination; CMV, cytomegalovirus; MSM, men who have sex with men.

Table 3 INSTI Drug Resistance and Resistance-Associated Mutations by Sanger Sequencing Among Treatment-Naïve HIV-1-Infected Patients (n=224)

Item	Patient Number (%)
INSTI drug resistance
Yes	2 (0.9)
No	222 (99.1)
Major resistance-associated mutations	0 (0)
Minor resistance-associated mutations	2 (0.9)
E138A	1 (0.4)
G163K	1 (0.4)
Substitutions^a	5 (2.2)
L74V	4 (1.8)
V151I	1 (0.4)
INSTI drug resistance
DTG	0 (0)
EVG	2 (0.9)
RAL	2 (0.9)

Notes: Definitions of major and minor mutations were derived from the 2017 IAS–USA (Topics in Antiviral Medicine) list¹² and Stanford database with a Stanford HIVdb score 10 were studied.⁶ aSubstitutions were H51L/R, L74V, P145R, V151I, and S230N.⁶

Abbreviations: INSTI, integrase strand-transfer inhibitor; DTG, dolutegravir; EVG, elvitegravir; RAL, raltegravir.

Table 4 Demographic Data of the HIV-1-Infected Patients Who Underwent Both Sanger Sequencing and NGS for INSTI Resistance (n=38)

Parameter		Patient Number (%)
Gender	Male	38 (100)
	Female	0 (0)
Age	Median (IQR)	25 (23–34)
Age cut-off point	<35	29 (76)
	≥35	9 (24)
Risk factor	Heterosexual	1 (3)
	MSM	37 (97)
Any class resistance	Yes	2 (5)
	No	36 (95)
HIV subtype	Non-B	4 (10)
	B	34 (90)
CD4 (cell/ul)	Minimum	91
	Maximum	668
	Median (IQR)	337 (234–438)
CD4 cut-off point (cell/ul)	<200	8 (21)
	≥200	30 (79)
	<350	20 (53)
	≥350	18 (47)
Viral load (Log)	Minimum	3.5
	Maximum	7.0
	Median (IQR)	4.9 (4.6–5.3)
Viral load cut-off point (Log)	<4	1 (3)
	≥4	37 (97)
Syphilis	Negative	26 (68)
	Positive	12 (32)
IHA-AMEBIASIS	≦128	36 (95)
	≧256	2 (5)
TOXOPLASMA-IgG	Negative	35 (92)
	Positive	3 (8)
CMV-IgG	Negative	0 (0)
	Positive	38 (100)
CRYPTOCOCCUS Ag	Negative	38 (100)
	Positive	0 (0)
HAV Ab	Negative	34 (90)
	Positive	4 (10)
HBs Ab	Negative	24 (63)
	Positive	14 (37)
HBs Ag	Negative	33 (87)
	Positive	5 (13)
HBc Ab	Negative	28 (74)
	Positive	10 (26)
HCV Ab	Negative	38 (100)
	Positive	0 (0)

Abbreviations: IQR, interquartile range; HAV Ab, hepatitis A antibody; HBs Ab, hepatitis B surface antibody; HBs Ag, hepatitis B surface antigen; HBc Ab, hepatitis B core antibody; HCV Ab, hepatitis C virus antibody; IHA, indirect hemagglutination; CMV, cytomegalovirus; MSM, men who have sex with men; NGS, next-generation sequencing.

Table 5 Overall Frequency (%) of INSTI Resistance-Associated Mutations Among HIV-1-Infected Patients by NGS (n=38)^a

Mutation Sample	Y143H	L74M	E92G	T97A	S147G	S153F	S153Y	G163R
1					0.51
2					0.51
3
4
5					0.51
6					0.68
7					0.52
8					0.58
10					0.54
11
12			0.5
13					0.47
14
15
16					0.58
17				0.53	0.5			3.25
18				0.97			1.36
19		0.47
20				0.59	0.47
21
22
23	2.06
24			0.5		0.58
25
26
27					0.5
28
29	0.78
31		0.51	0.49
32			0.49
33
34					0.61
35
36
37						3.21
38					0.75
39
40

Note: ^aNo sample for 9 and 30.

Abbreviations: INSTI, integrase strand-transfer inhibitor; NGS, next-generation sequencing.

Figure 1 Percentage of HIV drug resistance and resistance-associated mutations to NRTIs, NNRTIs, PIs and INSTIs among 224 HIV-1-infected patients with GRT by sanger sequencing. The figure shows that a 8.9% had drug resistance to any of the four classes of anti-retroviral drugs, including 4% who had resistance to NRTIs, 5.8% to NNRTIs, 0.4% to PIs and 0.9% to INSTIs.

Abbreviations: NRTI, nucleoside reverse transcriptase inhibitor; NNRTI, non-nucleoside reverse transcriptase inhibitor; PI, protease inhibitor; INSTI, integrase strand transfer inhibitor; GRT, genotypic drug-resistance testing.

Figure 2 The prevalence of drug resistance to NRTIs, NNRTIs, PIs and INSTIs among 224 HIV-1-infected treatment-naïve patients in southern Taiwan. The figure shows that 2.7% had resistance to lamivudine, emtricitabine, abacavir and stavudine, 1.8% had resistance to tenofovir, 5.8% had resistance to nevirapine, 4.9% had resistance to efavirenz, and 0.9% had resistance to raltegravir and elvitegravir.

Abbreviations: NRTI, nucleoside reverse transcriptase inhibitor; NNRTI, non-nucleoside reverse transcriptase inhibitor; PI, protease inhibitor; INSTI, integrase strand transfer inhibitor.

Figure 3 The prevalence of drug resistance-associated mutations to NRTIs, NNRTIs, PIs and INSTIs among 224 HIV-1-infected patients with transmitted drug resistance. The figure shows that the most common drug resistance-associated mutations were M184V (1.3%) and K65R (1.3%) for NRTIs, V179D (4.5%), V106I (2.7%) and K103N (1.3%) for NNRTIs, and L10I (13.4%) and A71T (5.8%) for PIs. Overall, 0.4% of the patients had drug resistance-associated mutations to G163K and E138A.

Abbreviations: NRTI, nucleoside reverse transcriptase inhibitor; NNRTI, non-nucleoside reverse transcriptase inhibitor; PI, protease inhibitor; INSTI, integrase strand transfer inhibitor.

Figure 4 Phylogeny from 38 patients enrolled from the 2017 VCT program who received NGS and sanger sequencing were inferred from the integrase gene sequences. (Subtype B reference strain: AB869134, AF86817, AB097870, AY173951. Subtype 01AE reference strain: AB869160). One cluster was detected (sample 19 and 31).

Abbreviations: VCT, voluntary counselling and testing; NGS, next-generation sequencing; INSTI, integrase strand transfer inhibitor.

Wensing AM, Calvez V, Ceccherini-Silberstein F, et al. update of the drug resistance mutations in HIV-1. Top Antivir Med. 2019;2019(27):111–121.

 Google Scholar

Chang SY, Lin PH, Cheng CL, et al. Prevalence of Integrase Strand Transfer Inhibitors (INSTI) resistance mutations in taiwan. Sci Rep. 2016;6(1):35779. doi:10.1038/srep3577927779200

 PubMed Web of Science ®Google Scholar