Genetic Diversity of the Flavohemoprotein Gene of Giardia lamblia: Evidence for High Allelic Heterozygosity and Copy Number Variation

Figures & data

Table 1 Primers Designed for Gene-PCR of the gFlHb of Giardia lamblia Sub-Assemblage AII and Assemblage B All Primers Were Ordered from Eurofins Genomics (Ebersberg, Germany)

Primer Set	Type^a	Sequence, 5’-3’	Amplicon Size	Melting Temperature [°C]
DHA2_154000	F	CGCCACCACAAGCGATCATT	1433	59.4
DHA2_154000	R	GTGTGTAGAGCGATTACAT		52.4
GSB_151570	F	CGGCCTTCAGGTACTTCCCC	1807*	63.5
GSB_151570	R	GAGACCAAAAGTCCATATGAACT		57.1

Notes: *The GSB gFlHb gene exists in a longer version which is not likely to be the true length, however, the whole annotated gene obtained from the reference genome was covered by the primers. Only the CDS length of 1377 bp (same as in sub-assemblage AII) was analyzed in the present study.

Abbreviations: ^aF, forward; R, reverse.

Table 2 Estimates of gFlHb Copy Numbers in PacBio and Illumina Sequencing Data, Number of Clones, and Identified Alleles and SNVs in Cloned Sequences

Isolate	Average Coverage 5 Largest Contigs	Coverage gFlHb CDS	Estimated Number of Copies by Illumina	Copies Found in PacBio	Number of Clones Sanger Sequenced	Unique gFlHb Alleles per Isolate	Number of HC SNVs in all Clones	HC nsSNVs in all Clones
P033	30.6	64.9	2.1	Nd	11	3	18	6
P034	29.7	64.9	2.2	Nd	12	2	6	2
P064	94.2	97.9	1	2	11	2	6	2
P316	26.0	106.3	4.1	Nd	11	5	13	4
P324	30.1	97.9	3	Nd	NA	NA	NA	NA
P361	31.0	84.5	2	Nd	14	4	13	4
P368	42.4	139.9	3	Nd	5	2	23	9
P392	51.0	183.3	3.6	4	12	8	32	12
P403	27.8	86.9	3	Nd	8	2	26	5
P407	43.5	235.9	5.4	3	12	8	48	16
P478	11.5	106.3	3.4	Nd	9	7	34	10
P506	29.8	64.9	2	Nd	12	2	7	3
P344	23.7	45.4	2	2	15	9	22	7
P387	36	126.3	3.5	2	11	9	24	13
P413	23	110.6	4.8	Nd	13	12	28	21
P424	22.4	114.6	5.1	6	17	9	20	12
P427	17.2	24.9	1.5	2	14	3	21	10
P428	14	20.5	1	Nd	NA	NA	NA	NA
P433	13.4	13.1	1.5	Nd	NA	NA	NA	NA
P458	26.1	44.2	1.7	3	7	2	14	7

Abbreviations: Nd, not done; HC, high confidence; CDS, coding regions.

Figure 1 Phylogenetic tree of all the alleles of gFlHb found in the sub-assemblage AII isolates and gFlHb copies found in the PacBio sequencing data. A is abbreviated for allele, and the number of clones representing each allele is listed in the parenthesis.

Figure 2 Phylogenetic tree of all the alleles found in the assemblage B isolates and gFlHb copies found by PacBio sequencing. A is an abbreviation of allele, and the number of clones representing each allele is listed in the parenthesis.

Figure 3 Cartoon representation of homology models created for gFlHb from assemblage A and B. Heme binding globing domain is presented in purple, FAD-binding domain in green and C-terminal FAD- binding domain in cyan. Heme and FAD were fitted to the homology model and are presented by stick representation. Detected nsSNV-induced mutations to the amino acid sequences for individual isolates are presented in the table. Mutations possibly affecting directly to protein function by disturbing the heme or FAD binding are indicated with red in both cartoon models and in the table. The mutation marked as STOP-49Q introduces a stop codon into the sequence interrupting the protein synthesis.