Screening of Antimicrobial Resistance Genes and Epidemiological Features in Hospital and Community-Associated Carbapenem-Resistant Pseudomonas aeruginosa Infections

Figures & data

Table 1 Primers Used in the Amplification of Selected Genes

Primer	5′-3′ Sequence	Amplicon Size (bp)	Tm (°C)	Reference
VEB	F- ATTTCCCGATGCAAAGCGT	542	55	[^Citation9]
	R- TTATTCCGGAAGTCCCTGT
PER	F- ATGAATGTCATCACAAAAT	927	50	[^Citation10]
	R- TCAATCCGGACTCACT
IMP	F:CATGGTTTGGTGGTTCTTGT	488	56	[^Citation11]
	R:ATAATTTGGCGGACTTTGGC
VIM	F:ATTGGTCTATTTGACCGCGTC	780	58	[^Citation11]
	R:TGCTACTCAACGACTGAGCG
NDM	F:TGGAATTGCCCAATATTATGC	813	54	[^Citation12]
	R:TCAGCGCAGCTTGTCGGCCATGC
KPC	F: CGTTCTTGTCTCTCATGGCC	796	52	[^Citation13]
	R: CCTCGCTGTGCTTGTCATCC
OXA-48	F:CAGTCAAGTTCAACCCAACCG	438	55	[^Citation14]
	R:GCGTGGTTAAGGATGAACAC
OXA- 51	F: TAATGCTTTGATCGGCCTTG	353	52	[^Citation15]
	R:TGGATTGCACTTCATCTTGG
OXA–23	F:GATCGGATTGGAGAACCAGA	501	52	[^Citation15]
	R:ATTTCTGACCGCATTTCCAT

Abbreviations: Tm, melting temperature; bp, base pairs.

Table 2 Distribution of Cases According to Service and Intensive Care Units

	Total (n=70)	HAI (n=27)	CAI (n=43)
Services, n (%)
IMICU	14 (20.0)	11 (40.7)	3 (7.0)
SICU	12 (17.2)	8 (29.6)	4 (9.3)
ARICU	4 (5.7)	3 (11.1)	1 (2.3)
CVSICU	3 (4.3)	1 (3.7)	2 (4.7)
CICU	2 (2.8)	1 (3.7)	1 (2.3)
Other services	35 (50.0)	3 (11.1)	32 (74.4)

Abbreviations: IMUCU, Internal Medicine Intensive Care Unit; SICU, Surgery Intensive Care Unit; ARICU, Anesthesia and Reanimation Intensive Care Unit; CVSICU, Cardiovascular Surgery Intensive Care Unit; CICU, Coronary Intensive Care Unit. 

Table 3 Comparison of Demographic and Pathological Characteristics of HAI (n=27) and CAI (n=43) Groups

	Total	HAI	CAI	Statistics
	n=70	n=27	n=43	z, χ2	p value
Age (year)	66 (17–92)	73 (18–92)	64 (17–89)	−1.829	0.067
Over 65 years old		16 (81±6.9)	20 (75±6.6)	(%95 confidal)	0.0013
Duration of stay (days)	19.5 (1–72)	22 (14–72)	18 (1–39)	−2.921	0.003
Gender
Women	27 (38.6)	9 (33.3)	18 (41.9)	0.509	0.476
Male	43 (61.4)	18 (66.7)	25 (58.1)
Surgery history (last 1 month)	15 (21.4)	9 (33.3)	6 (14.0)	3.700	0.054
Hospital history (last 3 months)	47 (67.1)	16 (59.3)	31 (72.1)	1.238	0.266
Antibiotic utilization (last 3 months)	53 (75.7)	22 (81.5)	31 (72.1)	0.795	0.373
First (Pre) diagnosis, n (%)				–	–
Respiratory pathologies	19 (27.1)	10 (37.0)	9 (20.9)
Urinary pathologies	13 (18.6)	0	13 (30.2)
Neurological pathologies	9 (12.9)	5 (18.5)	4 (9.3)
GIS pathologies	8 (11.4)	5 (18.5)	3 (7.0)
CVS pathologies	6 (8.6)	2 (7.4)	4 (9.3)
Trauma	6 (8.6)	3 (11.1)	3 (7.0)
Soft-tissue pathologies	5 (7.1)	0	5 (11.6)
Oncological pathologies	4 (5.7)	2 (7.4)	2 (4.7)
Hospitalization indication, n (%)
Respiratory Failure	14 (20.0)	6 (22.2)	8 (18.6)	0.136	0.713
Mental changes	4 (5.7)	4 (14.8)	0	6.756*	0.019
Hemodynamic instability	4 (5.7)	1 (3.7)	3 (7.0)	0.330*	0.498
Post CPR	7 (10.0)	4 (14.8)	3 (7.0)	1.132*	0.253

Note: *Fisher’s exact test.

Table 4 Diagnosis, Clinical Features and Risk Factors of HAI (n =27) and CAI (n =43) Groups

	Total	HAI	CAI	Statistics
	n=70	n=27	n=43	z, χ^2	p value
Final diagnosis on the PA isolation date (%)
VAP (ventilator-associated pneumonia)	13 (18.6)	13 (48.2)	0	-	-
KSI (blood stream infection)	6 (8.6)	6 (22.2)	0
HP (hospital pneumonia)	6 (8.6)	6 (22.2)	0
HUTI (hospital urinary tract infection)	1 (1.4)	1 (3.7)	0
UTI (urinary tract infection)	16 (22.9)	0	16 (37.2)
CAP (community-associated pneumatic)	16 (22.9)	0	16 (37.2)
STI (soft tissue infection)	6 (8.5)	0	6 (14.0)
IAI (intra-abdominal infection)	3 (4.2)	0	3 (6.9)
CBSI (community-bloodstream infection)	2 (2.9)	0	2 (4.7)
Meningitis	1 (1.4)	1 (3.7)	0
Comorbid patients, n (%)
CVS diseases	27 (38.6)	12 (44.4)	15 (34.9)	0.640	0.424
KOAH	12 (17.1)	5 (18.5)	7 (16.3)	0.059*	0.526
Neurological diseases	9 (12.9)	5 (18.5)	4 (9.3)	1.257*	0.292
Diabetes mellitus	9 (12.9)	3 (11.1)	6 (14.0)	0.120*	0.517
Malignant diseases	7 (10.0)	3 (11.1)	4 (9.3)	0.060*	0.554
Renal diseases	6 (8.6)	1 (3.7)	5 (11.6)	1.329*	0.394
Skin-soft tissue pathologies	5 (7.1)	2 (7.4)	3 (7.0)	0.005*	0.645
Invasive procedures and applications during the PA isolation period, n (%)
Hemodialysis	24 (34.3)	19 (70.4)	5 (11.6)	25.402	0.000
Endotracheal application	27 (38.6)	23 (85.2)	4 (9.3)	40.307	0.000
Enteral nutrition	49 (70.0)	16 (59.3)	33 (76.7)	2.415	0.120
Peripheral venous catheter	48 (68.6)	18 (66.7)	30 (69.8)	0.074	0.786
Nasogastric	26 (37.1)	16 (59.3)	10 (23.3)	9.209	0.002
Peripheral artery catheter	24 (34.3)	19 (70.4)	5 (11.6)	25.402	0.000
Decubitus	22 (31.4)	17 (63.0)	5 (11.6)	20.281	0.000
Central venous catheter	21 (30.0)	11 (40.7)	10 (23.3)	2.415	0.120
Urinary catheter	26 (37.1)	16 (59.3)	10 (23.3)	9.209	0.002
Mechanical ventilator	21 (30.0)	17 (63.0)	4 (9.3)	22.742	0.000
Total parenteral nutrition	14 (20.0)	3 (11.1)	11 (25.6)	2.171	0.141
Transfusion	14 (20.0)	6 (22.2)	8 (18.6)	0.136	0.713
Cystostomy	13 (18.6)	6 (22.2)	7 (16.3)	0.387	0.534
Bronchoscopy	7 (10.0)	7 (16.3)	0	4.884*	0.038
Steroid	7 (10.0)	3 (11.1)	4 (9.3)	0.060*	0.554
Tracheotomy	3 (4.3)	1 (3.7)	2 (4.7)	0.036*	0.671
Chest tube	3 (4.3)	0	3 (7.0)	1.968*	0.279

Note: *Fisher’s exact test.

Table 5 Resistance Rates of P. aeruginosa Isolates

Antibiotics	Resistant	Sensitive	Medium Sensitive
Ceftazidim	30 (42.9)	34 (48.6)	6 (8.6)
Cefepim	34 (48.6)	29 (41,4)	7 (10.0)
Cefoperazone	12 (17.1)	58 (82.9)	0
Cefoperazone-sulbactam	10 (14.3)	60 (85.7)	0
Piperacillin	36 (51.4)	30 (42.9)	4 (5.7)
Piperacillin-tazobactam	34 (48.6)	29 (41.4)	7 (10.0)
Amikacin	10 (14.4)	54 (77.0)	6 (8.6)
Gentamicin	12 (17.1)	54 (77.0)	4 (5.7)
Ciprofloxacin	18 (25.7)	47 (67.2)	5 (7.1)
Levofloxacin	28 (40.0)	38 (54.3)	4 (5.7)
Colistin	0	70 (100)	0
Imipenem	13 (18.6)	56 (80.0)	1 (1.4)
Meropenem	18 (25.7)	49 (70.0)	3 (4.3)
Carbapenem resistance	24 (34.3)	46 (65.7)	0

Table 6 β-Lactamase Genes Identified in P. aeruginosa Isolates

Genes	Isolate Numbers	Positive Number (%)
blaVEB	3, 6, 16, 23*, 26, 28, 30, 33, 37, 38*, 46, 48, 50*, 53*, 56, 60, 61*, 65*	18 (25.71)
blaPER	3, 8, 4, 6, 7*, 13, 20*, 28, 29, 36*, 37, 55*, 56, 61*, 64*, 65*, 66*, 67*	18 (25.71)
blaKPC	3, 4, 6, 16, 28, 36*, 37, 38*, 43, 50*, 56, 66*	12 (17.14)
blaNDM	6, 7*, 9, 10, 11, 26, 27*, 28, 29, 30, 36*, 37, 38*, 43, 46, 53*, 56, 68	18 (25.71)
blaIMP	7*, 23*, 30, 33, 36*	5 (7.14)
blaVIM	26	1 (1.42)
blaOXA-23	60	1 (1.42)
blaOXA-48	6, 7*, 9, 20*, 26, 28, 37, 38*, 46, 59, 60, 67*	12 (17.14)

Note: *Indicates community-associated samples.

Figure 1 PFGE analysis of P. aeruginosa isolates generated seven major clusters (profile 1 (A1, A2, B, C, D, E), F1a, F1b, F1c, F2, G1 and G2). Community-associated samples were shown as underlined.

Table 7 Epidemic Characteristics of 6 Patients in Which Other Microorganisms Were Isolated in Addition to P. aeruginosa

Sample No	65	66	67	68	69	70
Sample	CSF	TAC	Blood	Blood	TAC	Urine
Age	42	82	84	88	87	47
Gender	Man	Man	Man	Women	Man	Man
Holding dates	30.07.2016	15.05.2016	08.04.2016	06.09.2016	11.07.2016	22.06.2016
	22.12.2016	16.08.2016	24.04.2016	06.11.2016	01.11.2016	24.08.2016
Holding time (day)	145	93	16	61	113	62
Service	ARICU - IMICU PCU	IMICU	IMICU	IMICU	IMICU	IDS
Comorbidity or additional disease	IVTA – TSH	CRI	PTC	PTC	KOAH	NBS
Positive simultaneous breeding: another example	Blood -TAC	Blood	TAC	Blood - Urine	TAC	Urine
Positive simultaneous growth: other microorganism.	Acinetobacter spp. Klebsiella pneumoniae	Acinetobacter spp.	Candida spp.	Acinetobacter spp. Klebsiella spp.	Acinetobacter spp.	Klebsiella spp.
History of using antibiotics in the last 3 months	NO	YES	YES	YES	YES	YES
The fate of the patient	EX	EX	EX	EX	EX	Following

Moubareck C, Bre´mont S, Conroy MC, Courvalin P, Lambert T. GES-11, a novel integron-associated GES variant in Acinetobacter baumannii. Antimicrob Agents Chemother. 2009;53(8):3579–3581. doi:10.1128/AAC.00072-0919451292

 PubMed Web of Science ®Google Scholar

Celenza G, Pellegrini C, Caccamo M, Segatore B, Amicosante G, Perilli M. Spread of blaCTX-M-type and blaPER-2 β-lactamase genes in clinical isolates from Bolivian hospitals. J Antimicrob Chemother. 2006;57(5):975–978. doi:10.1093/jac/dkl05516510850

 PubMed Web of Science ®Google Scholar

Jeon BC, Jeong SH, Bae IK, Kwon SB, Lee K, Young D. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23 β-lactamase in Korea. J Clin Microbiol. 2005;43(5):2241–2245. doi:10.1128/JCM.43.5.2241-2245.200515872249

 PubMed Web of Science ®Google Scholar

Cicek AC, Saral A, Iraz M, et al. OXA and GES-type β-lactamases predominate in extensively drug-resistant Acinetobacter baumannii isolates from a Turkish University Hospital. Clin Microbiol Infect. 2014;20(5):410–415. doi:10.1111/1469-0691.1233823957892

 PubMed Web of Science ®Google Scholar

Poirel N, He´ritier C, Tolun V, Nordmann P. Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae. Antimicrob Agents Chemother. 2004;48(1):15–22. doi:10.1128/aac.48.1.15-22.200414693513

 PubMed Web of Science ®Google Scholar

Poirel L, Walsh TR, Cuvillier V, Nordmann P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn Microbiol Infect Dis. 2011;70(1):119–123. doi:10.1016/j.diagmicrobio.2010.12.00221398074

 PubMed Web of Science ®Google Scholar

Woodford N, Ellington MJ, Coelho JM, et al. Multiplex PCR for genes encoding prevalent OXA carbapenemases in Acinetobacter spp. Int J Antimicrob Agents. 2006;27(4):351–353. doi:10.1016/j.ijantimicag.2006.01.00416564159

 PubMed Web of Science ®Google Scholar