Comparative Study of CTX-M-15 Producing Escherichia coli ST131 Clone Isolated from Urinary Tract Infections and Acute Diarrhoea

Figures & data

Table 1 PCR Primers Used in the Study

Primer	Primers (5_ to 3_)	Amplicon Size (bp)	Annealing Temperature (°C)	Reference
gadA	F-GATGAAATGGCGTTGGCGCAAG R-GGCGGAAGTCCCAGACGATATCC	373	65	[^Citation17]
chuA	F- ATGATCATCGCGGCGTGCTG R-AAACGCGCTCGCGCCTAAT	281
yjaA	F-TGTTCGCGATCTTGAAAGCAAACGT R-ACCTGTGACAAACCGCCCTCA	216
TSPE4.C2	F-GCGGGTGAGACAGAAACGCG R- TTGTCGTGAGTTGCGAACCCG	152
CTX-M-15	F-CACACGTGGAATTTAGGGACT R-GCCGTCTAAGGCCATAAACA	996	55	[^Citation18]
pabBST131-O25b	F- TCCAGCAGGTGCTGGATCGT R- GCGAAATTTTTCGCCGTACTGT	347	63	[^Citation19]
trpAST131-O16	F- AAAACCGCGCCGCGTTACCT R- CCAGAAATCGCGCCCGCATT	145	63	[^Citation20]

Figure 1 Antibiotic resistance, ESBLs, and MDR distributions among urinary and intestinal isolates.

Abbreviations: AMC, Amoxicillin-clavulanate; CAZ, Ceftazidime; CRO, Ceftriaxone; SXT, sulfamethoxazole-Trimethoprim; AMK, Amikacin; IPM, Imipenem; CIP, Ciprofloxacin.

Table 2 Differentiation between E coli Isolates from Urinary and Intestinal Origin

		No. (%) of Strains		P-value
		Urinary Isolates (n=105)	Intestinal Isolates (n=100)
Phylogenetic group	B2	32 (30.5%)	5 (5%)	<0.001*
	B1	30 (28.6%)	39 (39%)	0.114
	A	26 (24.8%)	44 (44%)	0.004*
	D	17 (16.2%)	12 (12%)	0.398
O25-ST131 (pabB positive)		89 (84.8%)	47 (47%)	<0.001*
MDR		65 (61.9%)	56 (56%)	0.39
ESBL positive (synergy test)		79 (75.2%)	71 (71%)	0.494
CTX-M-15 positive		57 (54.3%)	66 (66%)	0.087
O16-ST131 (trpA)		0	0	–

Note: *P-value is significant.

Abbreviation: n, number.

Table 3 Differentiation between O25-ST131 and Non-O25-ST131 E. coli Isolates

n= (Urinary+Intestinal)		O25-ST131		Non O25-ST131		P-value
		Urinary Isolates	Intestinal Isolates	Urinary Isolates	Intestinal Isolates
Phylogenetic group	B2, n=(32+5)	30/32 (93.8%)	5/5 (100%)	2/32 (6.2%)	0/5 0	1.000
	B1, n=(30+39)	23/30 (76.7%)	12/39 (30.8%)	7/30 (23.3%)	27/39 (69.2%)	<0.001*
	A, n=(26+44)	24/26 (92.3%)	25/44 (56.8%)	2/26 (7.7%)	19/44 (43.2%)	0.002*
	D, n=(17+12)	12/17 (70.6%)	5/12 (41.7%)	5/17 (29.4%)	7/12 (58.3%)	0.148
MDR n= (65+56)		58 (89.2%)	42 (75%)	7 (10.8%)	14 (25%)	0.039*
ESBLs positive (synergy test) n=(79+71)		66 (83.5%)	41 (57.7%)	13 (16.5%)	30 (42.3%)	<0.001*
CTX-M-15, n=(57+66)		45 (78.9%)	35 (53%)	12 (21.1%)	31 (47%)	0.004*
Antibiotic resistance	AMC (88+80)	74 (84.1%)	45 (56.2%)	14 (15.9%)	35 (43.8%)	<0.001*
	CAZ (62+53)	53 (85.5%)	38 (71.7%)	9 (14.5%)	15 (28.3%)	0.07
	CRO (78+71)	66 (84.6%)	42 (59.2%)	12 (15.4%)	29 (40.8%)	0.001*
	STX (66+54)	59 (89.4%)	41 (75.9%)	7 (10.6%)	13 (24.1%)	0.049*
	AMK (25+21)	24 (96%)	14 (66.7%)	14 (4%)	7 (33.3%)	0.016*
	CIP (31+35)	25 (80.6%)	29 (82.9%)	6 (19.4%)	6 (17.1%)	0.816
	IPM (2+4)	2 (100%)	4 (100%)	0	0

Note: *P-value is significant.

Abbreviations: MDR, Multi-Drug Resistant; ESBLs, Extended Spectrum B-Lactamases; AMC, Amoxicillin-clavulanate; CAZ, Ceftazidime; CRO, Ceftriaxone; SXT, sulfamethoxazole -Trimethoprim; AMK, Amikacin; IPM, Imipenem; CIP, Ciprofloxacin; n, number.

Figure 2 Screening of pabB gene for O25-ST131 in E. coli isolates. Lane 1, 100 bp molecular marker (iNtRON Biotechnology, South Korea); Lane 2–6 show (pabB gene) 347 bp; Lane 7 (positive control); Lane 8 (negative control).

Figure 3 Phylogenetic distribution of O25-ST 131 and non O25-ST131 E. coli isolates.

Table 4 Distribution of Phenotypic ESBLs Producing E coli Isolates According to O25-ST131, CTX-M-15, Phylogenetic Group, and Antibiotypes

E coli Pattern (EC)	Source	No of Isolates	O25-ST131	Non O25-ST131	CTX-M-15 +ve	CTX-M-15 -ve	Phylogenetic Group				Antibiotype
							A	B1	D	B2
EC1	Urinary	21	15	6	12	9	2	9	4	6	AMC, CAZ, CRO, SXT, CIP
	Intestinal	17	15	2	15	2	8	7	1	1
EC2	Urinary	18	18	0	13	5	3	4	4	7	AMC, CAZ, CRO, SXT, AMK
	Intestinal	5	3	2	5	0	4	1	0	0
EC3	Urinary	7	3	4	7	0	0	1	4	2	AMC, CRO
	Intestinal	12	0	12	12	0	3	9	0	0
EC4	Urinary	9	9	0	6	3	2	4	0	3	AMC, CAZ, CRO, SXT
	Intestinal	11	7	4	11	0	8	1	2	0
EC5	Urinary	9	7	2	8	1	4	0	0	5	AMC, CAZ, CRO
	Intestinal	5	1	4	4	1	4	1	0	0
EC6	Urinary	4	4	0	2	2	1	1	1	1	AMC, CRO, SXT
	Intestinal	4	3	1	4	0	4	0	0	0
EC7	Urinary	3	3	0	2	1	2	1	0	0	AMC, CRO, CIP
	Intestinal	0	0	0	0	0	0	0	0	0
EC8	Urinary	3	3	0	1	2	2	0	0	1	AMC, CRO, SXT, AMK
	Intestinal	1	0	1	1	0	1	0	0	0
EC9	Urinary	1	1	0	0	1	0	0	0	1	AMC, CAZ, AMK
	Intestinal	0	0	0	0	0	0	0	0	0
EC10	Urinary	1	1	0	1	0	0	0	0	1	AMC, CAZ, CRO, CIP
	Intestinal	2	1	1	2	0	0	1	1	0
EC11	Urinary	1	0	1	1	0	0	0	0	1	AMC, CAZ, SXT, AMK
	Intestinal	0	0	0	0	0	0	0	0	0
EC12	Urinary	1	1	0	0	1	0	0	1	0	AMC, CAZ, CRO, SXT, AMK, IPM
	Intestinal	0	0	0	0	0	0	0	0	0
EC13	Urinary	1	1	0	1	0	0	0	0	1	AMC, CAZ, CRO, SXT, CIP, IPM
	Intestinal	3	3	0	3	0	0	0	0	3
EC14	Urinary	0	0	0	0	0	0	0	0	0	AMC, CAZ. CRO, SXT, AMK, CIP
	Intestinal	7	6	1	5	2	0	4	2	1
EC15	Urinary	0	0	0	0	0	0	0	0	0	AMC, CAZ, CRO, AMK, CIP
	Intestinal	2	1	1	0	2	0	1	1	0
EC16	Urinary	0	0	0	0	0	0	0	0	0	AMC, CAZ, CRO, AMK, CIP
	Intestinal	1	0	1	1	0	0	1	0	0
EC17	Urinary	0	0	0	0	0	0	0	0	0	AMC, CAZ, CRO, SXT, AMK, CIP, IPM
	Intestinal	1	1	0	1	0	0	0	1	0
Total (percent to ESBLs)	Urinary	79	66 (83.5%)	13 (16.5%)	54 (68.4%)	25 (31.1%)	16 (20.3%)	20 (25.3%)	14 (17.7%)	29 (36.7%)
	Intestinal	71	41 (57.7%)	30 (43.3%)	64 (90.1%)	7 (9.9%)	32 (45.1%)	26 (36.6%)	8 (11.3%)	5(7%)
P-value			<0.001*		0.001*		<0.001*

Note: *P-value is significant.

Abbreviations: AMC, Amoxicillin-clavulanate; CAZ, Ceftazidime; CRO, Ceftriaxone; SXT, sulfamethoxazole-Trimethoprim; AMK, Amikacin; IPM, Imipenem; CIP, Ciprofloxacin.

DoumithM, DayMJ, HopeR, WainJ, WoodfordN. Improved multiplex PCR strategy for rapid assignment of the four major Escherichia coli phylogenetic groups. J Clin Microbiol. 2012;50(9):3108–3110. doi:10.1128/JCM.01468-1222785193

 PubMed Web of Science ®Google Scholar

PatersonDL, HujerKM, HujerAM, et al. Extended-spectrum beta-lactamases in Klebsiella pneumoniae bloodstream isolates from seven countries: dominance and widespread prevalence of SHV- and CTX-M-type beta-lactamases. Antimicrob Agents Chemother. 2003;47(11):3554–3560. doi:10.1128/aac.47.11.3554-3560.200314576117

 PubMed Web of Science ®Google Scholar

ClermontO, DhanjiH, UptonM, et al. Rapid detection of the O25b-ST131 clone of Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob Chemother. 2009;64(2):274–277. doi:10.1093/jac/dkp19419474064

 PubMed Web of Science ®Google Scholar

JohnsonJR, ClermontO, JohnstonB, et al. Rapid and specific detection, molecular epidemiology, and experimental virule`nce of the O16 subgroup within Escherichia coli sequence Type 131. J Clin Microbiol. 2014;52:1358–1365. doi:10.1128/JCM.03502-1324501035

 PubMed Web of Science ®Google Scholar