Antimicrobial Resistance Pattern of Bacterial Meningitis Among Patients in Quetta, Pakistan

Figures & data

Table 1 The Primer Sequences for Diagnosis of Bacterial Isolates BM Patients

S. No.	Strain	Primer 16S rRNA	bps	Tm Values	Reference
1.	E. coli	Forward primer= GGGAGTAAAGTTAATACCTTTGC Reverse primer= CTCAAGCTTGCCAGTATCAG	204	58	^Citation46
2.	S. pneumoniae	Forward primer= CCACACTGGGACTGAGACAC Reverse primer= TCAACCTTGCGGTCGTACTC	598	59	This study
3.	S. aureus	Forward primer = ACGGTCTTGCTGTCACTTATA Reverse primer = TACACATATGTTCTTCCCTAATAA	257	57	^Citation47
4.	K. pneumoniae	Forward primer= TCTGAGAGGATGACCAGCCA Reverse primer= GTTTACGGCGTGGACTACCA	525	59	This study
5.	N. Meningiidtis	Forward primer = TTTTGGACAATGGGCGCAAG Reverse primer = GGGTCCCCGTCAATTCCTTT	568	59	This study
6.	H. influenzae	Forward primer = ATACCCTGGTAGTCCACGCT Reverse primer = AGTTGCAGACTCCAATCCGG	528	60	This study

Table 2 Demographics of Bacterial Meningitis Infected Patients

Characteristics	BM Cases n(%)	Non-BM Cases n(%)	Total n(%)	p-value
Total	321 (35.9%)	573 (64.1%)	894 (100%)
Gender
Male	186 (20.8%)	342 (38.3%)	528 (59.1%)	0.611
Female	135 (15.1%)	231 (25.8%)	366 (40.9%)
Among various age groups
1 month- 3 months	94 (10.6%)	42 (4.7%)	136 (15.2%)	0.001*
4 months- 1 year	80 (8.9%)	128 (14.3%)	208 (23.3%)
2 years–12 years	46 (5.1%)	112 (12.5%)	158 (17.7%)
13 years–19 years	13 (1.5%)	46 (5.1%)	59 (6.6%)
20 years–40 years	17 (1.9%)	73 (8.2.4%)	90 (10.1%)
41 years–60 years	20 (2.2%)	85 (9.5%)	105 (11.7%)
61 years–99 years	51 (5.7%)	87 (9.7%)	138 (15.4%)
Resident
Rural	163 (18.2%)	215 (24.0%)	378 (42.3%)	0.001*
Urban	158 (17.7%)	358 (40.0%)	516 (57.7%)
Ethnicity
Pashtun	176 (19.7%)	306 (34.2%)	482 (53.9%)	0.343
Baloch	68 (7.6%)	113 (12.6%)	181 (20.2%)
Punjabi	51 (5.7%)	117 (13.1%)	168 (18.8%)
Hazara	26 (2.9%)	37 (4.1%)	63 (7%)
Socioeconomic status
Lower class <20K PKR per month	173 (19.4%)	243 (27.2%)	416 (46.5%)	0.003*
Middle class 21k–50k PKR per month	119 (13.3%)	255 (28.5%)	374 (41.8%)
High class >50k PKR per month	29 (3.2%)	75 (8.4%)	104 (11.6%)
Education level
Illiterate	234 (26.2%)	361 (40.5%)	595 (66.6%)	0.003*
Literate	87 (9.7%)	212 (23.7%)	299 (33.4%)
Survival rate
Mortality	36 (4%)	13 (1.5%)	49 (5.5%)	0.001*
Survive	285 (31.5%)	560 (63%)	867 (94.5%)
Case fatality rate	36 (11%)	–	36 (11%)
Hospital admitted
BMCH	184 (20.6%)	322 (36.0%)	506 (56.6%)	0.745
DHQ	137 (15.3%)	251 (28.1%)	388 (43.4%)

Note: *Statistically significant; 20K= 20,000; 50k= 50,000; PKR = Pakistani Rupee.

Abbreviations: BMCH, Bolan Medical Complex Hospital; DHQ, District Hospital Quetta.

Figure 1 Frequency of positive bacterial meningitis cases.

Table 3 Comparative Analysis of Bacterial Culture and Gram Staining Among Bacterial Meningitis Cases

Test Performed	Bacterial Culture BM Cases		Total
	Positive Cases	Negative Cases
Gram Staining positive cases	50	0	50
Gram Staining negative cases	271	573	844
Total	321	573	894

Table 4 Incidence Rate of Isolated Bacterial Meningitis Pathogens Among Various Age Groups

Bacteria Causing Meningitis	Among Various Age Groups
	1 Month–3 Months n(%)	4 Months–1 Year n(%)	2–12 Years n(%)	13–19 Years n(%)	20–40 Years n(%)	41–60 Years n(%)	61–90 Years n(%)	Total n(%)
E. coli	25 (2.8%)	12 (1.3%)	0 (0%)	0 (0%)	0 (0%)	0 (0%)	3 (0.3%)	40 (4.5%)
S. aureus	12 (1.3%)	9 (1.0%)	13 (1.5%)	7 (0.8%)	6 (0.7%)	3 (0.3%)	11 (1.2%)	61 (6.8%)
K. Pneumoniae	5 (0.6%)	7 (0.8%)	0 (0%)	0 (0%)	0 (0%)	0 (0%)	5 (0.6%)	17 (1.9%)
S. pneumoniae	17 (1.9%)	27 (3.0%)	32 (3.6%	6 (0.7%)	11 (1.2%)	17 (1.9%)	20 (2.2%)	130 (14.5%)
H. influenzae	5 (0.6%)	8 (0.9%)	1 (0.1%)	0 (0%)	0 (0%)	0 (0%)	8 (0.9%)	22 (2.5%)
N. meningitidis	30 (3.4%)	17 (1.9%)	0 (0%)	0 (0%)	0 (0%)	0 (0%)	4 (0.4%)	51 (5.7%)

Table 5 Prognostic Factors of Bacterial Meningitis Infected Patients

Characteristics	Total BM Cases n(%)/ Out of 894	Non-Fatal BM Cases n (%)	Fatal BM Cases n (%)	P value	Odd Ratio	95% Confidence Interval
						Lower	Upper
Male	35 (61.4%)	159	27	0.512	0.634	0.0162	2.476^a
Female	22 (38.6%)	126	9
Antimicrobial therapy before LP
Within 24hrs	103 (11.5%)	89	14	0.909	1.097	0.225	5.341^b
After 24hrs	218 (24.4%)	196	22
CSF pH
7.32–7.5	90 (10.1%)	69	21	0.01*	0.129	0.026	0.645^c
7.6–8	231 (25.8%)	216	15
CSF appearance
Clear	120 (13.4%)	112	8	0.001*	22.847	3.830	136.287^d
Turbidity	201 (22.5%)	173	28
CSF protein level (Range)
14–45mg/dL	13 (1.5%)	11	2	0.993	1.015	0.038	27.049^e
> 45mg/dL (Range; 46–2500mg/dL)	308 (34.5%)	274	34
CSF glucose level (Range)
45–100mg/dL	64 (7.2%)	58	6	0.449	2.205	0.285	17.058^f
>100mg/dL (Range; 100–250 mg/dL)	9 (1%)	9	0	0.998.	6017.95	6015.951	6021.951^f
Low ≤45 mg/dL (Range; 0–44 mg/dL)	248 (27.7%)	218	30
CSF WBCs (Range)
21 to 100 cells/mm^3	86 (9.6%)	73	13	0.117	4.694	0.678	32.518^g
101 to 2000 cells/mm^3	190 (21.3%)	178	12	0.001*	24.177	3.932	148.644^g
≥2001 cells/mm^3	45 (5%)	34	11
Neutrophils
>10–≥30%	34 (4%)	25	9	0.118	0.184	0.022	1.535^h
>31–≥60%	101 (11.1%)	85	16	0.476	0.572	0.123	2.656^h
>61–≥90%	186 (20.8%)	175	11
Underlying diseases
Diabetes mellitus	29 (3.2%)	23	6	0.918	0.841	0.031	23.017
Hypertension	39 (4.4%)	34	5	0.944	1.082	0.119	9.855
COPD	105 (11.7%)	95	10	0.337	1.862	0.524	6.625
Liver disease	33 (3.7%)	28	5	0.765	0.735	0.097	5.544
Smoker	36 (4.02%)	29	7	0.220	0.092	0.002	4.170
Severe pneumonia	155 (17.3%)	134	21	0.513	0.518	0.072	3.720
Bacteremia	161 (18%)	139	22	0.861	0.853	0.145	5.028
Sinusitis	91 (10.2%)	75	16	0.557	0.633	0.138	2.906
Endocarditis	21 (2.3%)	17	4	0.05*	316.44	0.810	1235
Otitis media	24 (2.7%)	21	3	0.997	1.010	0.005	194.55

Notes: ^arelative to female gender; ^brelative to antimicrobial therapy not started within 24hrs; ^crelative to high pH; ^drelative to turbidity of CSF; ^erelative to High protein level; ^frelative to low glucose level; ^grelative to high WBCs (≥2001 cells/mm³); ^hrelative to high neutrophils level (>61–≥90%); *=p < 0.05 (significant value).

Figure 2 Clinical manifestations of bacterial meningitis patients.

Figure 3 16S rRNA gene PCR-based identification bacteria isolated from CSF of bacterial meningitis patients. (A) E. coli isolates with 204bp amplified fragments; (B) S. aureus solates 257bp amplified fragments; (C) K. pneumoniae isolates 525bp amplified fragments; (D) S. pneumoniae isolates 598bp amplified fragments; (E) H. influenzae isolates 528bp amplified fragments; (F) N. meningitidis isolates 568bp amplified fragments. M= molecular weight marker (1kb).

Figure 4 Phylogenetic relationship of bacterial isolates from bacterial meningitis patients with their reference strains. S. pneumoniae (MW405781, MW405782, MW405783, MW405784, MW405785, MT75569.1); E. coli (MT75572 MT916768, MT916769, MT916770); K. pneumoniae (MW208813, MW208814, MW208815, MW208816, MW208817, MT102939); S. aureus (MW148201.1, MW148202.1, MW148203.1, MW148204.1, MT75573.1); H. influenzae (MZ348556, MZ348557, MZ348558, MZ348559, MZ348560); N. meningitidis (MZ318247, MZ318248, MZ318249, MZ318250, MZ318251) isolated from BM patients of Balochistan were compared using 16S rRNA gene sequence with other reference strains using neighbor-joining phylogenetic tree. The bootstrap values were based on 1000 replicates in MEGA X software.

Table 6 The Antimicrobial Susceptibility Test Against Bacteria Isolated Bacterial Meningitis Patients

Bacterial Isolates
Antibiotics	Conc (µg)	E. coli		K. pneumoniae		S. aureus		S. pneumoniae		H. influenzae		N. meningitidis
		R n/N (%)	S n/N(%)	R n/N(%)	S n/N(%)	R n/N(%)	S n/N(%)	R n/N(%)	S n/N(%)	R n/N(%)	S n/N(%)	R n/N(%)	S n/N(%)
Amikacin	30	1/40 (2.5%)	39/40 (97.5%)	2/17 (11.8%)	15/7 (88.2%)	n.a.	n.a.	n.a.	n.a.	n.a.	n.a.	n.a.	n.a.
Amoxicillin	25	32/40 (80%)	8/40 (20%)	17/17 (100%)	0/17 (0%)	61/61 (100%)	0/61 (0%)	130/130 (100%)	0/130 (0%)	n.a.	n.a.	n.a.	n.a.
Ceftazidime	30	7/40 (17.5%)	33/40 (82.5%)	11/17 (64.7%)	6/17 (35.3%)	n.a.	n.a.	n.a.	n.a.	2/22 (10%)	20/22 (90%)	n.a.	n.a.
Ceftriaxone	30	11/40 (27.5%)	29/40 (72.5%)	8/17 (47.1%)	9/17 (52.9%)	n.a.	n.a.	n.a.	n.a.	3/22 (13.6%)	19/22 (86.4%)	2/51 (3.9%)	49/51 (96.1%)
Ciprofloxacin	5	12/40 (30%)	28/40 (70%)	7/17 (41%)	10/17 (558.8%)	2/61 (3.3%)	59/61 (96.7%)	n.a.	n.a.	1/22 (4.5%)	21/22 (95.5%)	4/51 (7.8%)	47/51 (92.2%)
Erythromycin	15	18/40 (45%)	22/40 (55%)	15/17 (88.2%)	2/17 (11.8%)	55/61 (90.2%)	6/61 (9.8%)	84/130 (64.6%)	46/130 (35.4%)	n.a.	n.a.	n.a.	n.a.
Gentamicin	10	7/40 (17.5%)	33/40 (82.5%)	6/17 (35.3%)	11/17 (64.7%)	13/61 (21.3%)	48/61 (78.7%)	35/130 (27%)	95/130 (73%)	n.a.	n.a.	n.a.	n.a.
Levofloxacin	5	5/40 (12.5%)	35/40 (87.5%)	6/17 (35.3%)	11/17 (64.7%)	16/61 (26.2%)	45/61 (73.8%)	0/130 (0%)	130/130 (100%)	0/22 (0%)	22/22 (100%)	n.a.	n.a.
Meropenem	10	3/40 (7.5%)	37/40 (92.5)	7/17 (41.2%)	10/17 (58.8%)	n.a.	n.a.	n.a.	n.a.	0/22 (0%)	22/22 (100%)	0/51 (0%)	51/51 (100%)
Oxytetracycline	30	22/40 (55%)	18/40 (45%)	15/17 (88.2%)	2/17 (11.8%)	40/61 (65.6%)	21/61 (34.4%)	27/130 (20.8%)	103/130 (79.2%)	5/22 (22.7%)	17 /22 (77.3%)	n.a.	n.a.
Rifampicin	05	n.a.	n.a.	n.a.	n.a.	34/61 (55.7%)	27/61 (44.3%)	77/130 (59%)	53/130 (41%)	3/22 (2.6%)	19/22 (86.4%)	1/51 (2%)	50/51 (98%)
Vancomycin	30	n.a.	n.a.	n.a.	n.a.	n.a.	n.a.	0/130 (0%)	130/130 (100%)	n.a.	n.a.	n.a.	n.a.

Abbreviations: Conc, concentration; R, resistance; S, susceptible; n/N(%), observed value/total tested value (percentage); n.a, not applicable.

Wang Y, Guo G, Wang H, et al. Comparative study of bacteriological culture and real-time fluorescence quantitative PCR (RT-PCR) and multiplex PCR-based reverse line blot (mPCR/RLB) hybridization assay in the diagnosis of bacterial neonatal meningitis. BMC Pediatr. 2014;14(1):224. doi:10.1186/1471-2431-14-22425200110

 PubMed Web of Science ®Google Scholar

Johnson EJ, Zemanick ET, Accurso FJ, Wagner BD, Robertson CE, Harris JK. Molecular identification of Staphylococcus aureus in airway samples from children with cystic fibrosis. PLoS One. 2016;11(1):e0147643. doi:10.1371/journal.pone.014764326808658

 PubMed Web of Science ®Google Scholar