Magnitude and Antimicrobial Susceptibility Profile of Salmonella Recovered from Export Abattoirs Located in East Shewa, Ethiopia

Figures & data

Figure 1 Geographical location of the study areas.

Notes:

Oromia,

Ethiopia regiona Admin,

Modjo Town,

Bishoftu Town,

Dukem Town.

Table 1 Primers Used to Detect Salmonella

Genome	Primers	Sequences (5’–3’)
Histidine transport operon gene	Forward	ACTGGCGTTATCCCTTTCTCTGGTA
	Reverse	ATGTTGTCCTGCCCCTGGTAAGAGA

Table 2 Socio-Demographic Characteristics of Human Study Participants in Selected Export Abattoirs, East Shewa, Ethiopia, from January to October 2020

Variables	Category	Frequency (N=75)	Percentages (%)
Age, years	22–35	25	33.0
	36–50	50	67.0
Sex	Male	55	73.3
	Female	20	26.6
Marital status	Married	50	67.0
	Single	25	33.0
Education	Primary	3	5.0
	Secondary	65	86.6
	Diploma	7	9.33
Residency	Modjo	45	70.0
	Bishoftu	15	15.0
	Dukem	15	15.0
Having certificate of food safety	Yes	65	86.6
	No	10	13.4
Periodical medical check-up	Yes	75	100
	No	-	-
Consumption of raw meat	Yes	1	5.0
	No	74	95
Food hygiene training	Yes	75	100
	No	-	-
Using personnel protective equipment	Yes	75	100
	No	-	-
Work experience years	5–8	62	85.0
	>9	13	15.0
Hand washing by soap and water after using toilet or touching any material	Yes	75	100
	No	-	-

Table 3 Detection Rate of Salmonella on Different Samples in Selected Export Abattoirs, East Shewa, Ethiopia, from January to October 2020

Sample Types	No. of Samples	No. of Positives	(95% CI)	Exact Test	P-value
Goat carcass swabs	100	10(6.67%)	(3.5, 11.19)
Knife swabs	60	4(6.67%)	(2.5, 16.64)
Goat skin swabs	60	7(11.67%)	(5.7, 23)
Human stool samples	75	0	0(0, 0)	0.304	0.188
Sheep carcass swabs	50	0	0(0, 0)
Total	345	21(100%)	(4.9, 11.2)

Figure 2 Agarose gel electrophoresis result of PCR product. Legend. Electrophoresis of PCR amplification after serial dilution of Salmonella sample in a 0.5% agarose gel stained with ethidium bromide. Agarose gel electrophoresis of Salmonella PCR products at 496 bp (16SrRNA gene) amplification of target region of histidine transport operon.

Abbreviations: Mw, molecular weight of marker: (Kb plus DNA ladder), Lane 1–21: number of PCR positives; NC, negative control; PC, positive control (S. Typhimurium: ATCC 14028).

Table 4 Antibiotic Susceptibility Profiles of Salmonella Isolates (n=21) in Selected Export Abattoirs, East Shewa, Ethiopia, from January to October 2020

Antimicrobials	Antibiotic Susceptibility Profiles
Kanamycin (K)	30 μg	S (%) 21(100%)	I (%) 0(0%)	R (%) 0(0)
Ciprofloxacin (CIP)	5 μg	20(95.24%)	0(0%)	1(4.76%)
Chloramphenicol (C)	30 μg	21(100%)	0(0%)	0(0%)
Cephalothin (CEP)	30 μg	21(100%)	0(0%)	0(0%)
Tetracycline (TE)	30 μg	19(90.47%)	0(0%)	2(9.52%)
Ampicillin (AM)	10 μg	20(95.24%)	0(0%)	1(4.76%)
Nalidixic acid (NA)	30 μg	20(95.24%)	0(0%)	1(4.76%)
Streptomycin (S)	10 μg	18(85.72%)	1(4.76%)	2(9.52%)
Gentamycin (GEN)	10 μg	21(100%)	0(0%)	0(0%)
Ceftriaxone (CRO)	30 μg	21(100%)	0(0%)	0(0%)
Amikacin (AN)	10 μg	20(95.2%)	0(0%)	1(4.76%)
Neomycin (N)	10 μg	0(0%)	20(95.2%)	1(4.76%)
Amoxacillin+Clavulanic acid (AMP)	20/10 µg	20(95.2%)	0(0%)	1(4.76%)
Sulfamethoxazole+ Trimethoprim (SXT)	1.25/23.75 μg	20(95.2%)	0(0%)	1(4.76%)

Abbreviations: S, susceptible; I, intermediate; R, resistant.

Table 5 Drug-Resistance Patterns of Salmonella Isolates from Studied Ethiopian Export Abattoirs from January to October 2020

No. of Drugs	Antibiotics	No. of Resistant Isolates	Isolate Origin
One	CIP, AM, NA, AN, N, AMP, and SXT	7(33.33%)	CS
Two	TE (2) and S (2)	2(9.04%)	SS

Abbreviations: CIP, ciprofloxacin; AM, ampicillin; NA, nalidic acid; AN, amikacin; N, neomycin; AMP, amoxacillin+clavulanic acid; SXT, sulfamethoxazole+trimethoprim; TE, tetracycline; S, streptomycin; CS, carcass swab; SS, skin swab.