Lemierre Syndrome Due to Dialister pneumosintes: A Case Report

Figures & data

Figure 1 Enhanced computed tomography of the neck. Black arrow indicates a right peritonsillar abscess. Black arrowhead shows a retropharyngeal abscess.

Figure 2 Enhanced computed tomography of the neck. Black arrow indicates right internal jugular vein thrombosis.

Figure 3 Clinical course of the present case.

Table 1 Primers Used for 16S rRNA Sequencing⁸

Primer Name	Sequence (5′ to 3′)
Amplification
27F	AGAGTTTGATCMTGGCTCAG
1492R	TACGGYTACCTTGTTACGACTT
Sequence
518F	CCAGCAGCCGCGGTAATACG
800R	TACCAGGGTATCTAATCC

Table 2 Antimicrobial Susceptibility of Dialister pneumosintes Isolated in the Present Case. Breakpoint Was Measured Based on Clinical and Laboratory Standards Institute M100-S26

Antibiotics	MIC (μg/mL)	Breakpoint	Susceptibility
Metronidazole	0.125	≤8	Susceptible
Ampicillin	0.25	≤0.5	Susceptible
Amoxicillin/clavulanate	≤0.5/0.035	≤4/2	Susceptible
Cefmetazole	≤2	≤16	Susceptible
Piperacillin/tazobactam	≤1/4	≤16/4	Susceptible
Imipenem	≤0.5	≤4	Susceptible
Meropenem	≤0.5	≤4	Susceptible
Clindamycin	≤0.25	≤2	Susceptible
Moxifloxacin	≤0.5	≤2	Susceptible

Abbreviation: MIC, minimum inhibitory concentration.

Figure 4 Colony morphology of the present strain on Brucella HK agar plate.

Figure 5 16S rRNA sequence of the isolated strain.

Figure 6 Hit taxon and strain name of the isolated strain.

Table 3 Reported Cases of Dialister pneumosintes-Associated Bacteremia, Including the Present Case

Year	Age (Years)	Sex	Diagnosis	Identification Method	Complicating with Cavities, Gingivitis, or Periodontitis	Initial Treatment	Outcome
2002^Citation4	17	M	Subdural empyema	16S rRNA sequence analysis	No	CTX, MNZ	Cured
2006^Citation5	27	F	Vaginosis	16S rRNA sequence analysis	No	IPM	Cured
2014^Citation18	62	F	Sinusitis	16S rRNA sequence analysis	Yes	CFPM	Cured
2016^Citation19	78	F	Periapical abscess	16S rRNA sequence analysis	Yes	CTRX, CLDM	Cured
2021^Citation20	13	F	Pneumonia	16S rRNA sequence analysis	No	PIPC/TAZ	Cured
2021^Citation21	30	F	Mediastinal abscess	16S rRNA sequence analysis	Yes	PIPC/TAZ	Cured
Present case	73	F	Peritonsillar and retropharyngeal abscess	16S rRNA sequence analysis	Yes	ABPC/SBT	Cured

Abbreviations: CTX, cefotaxime; MNZ, metronidazole; IPM, imipenem; CFPM, cefepime; CTRX, ceftriaxone; CLDM, clindamycin; PIPC/TAZ, piperacillin/tazobactam; ABPC/SBT, ampicillin/sulbactam.

Lane DJ. 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M, editors. Nucleic Acid Techniques in Bacterial Systematics. New York: John Wiley and Sons; 1991:115–175.

 Google Scholar

Lee MY, Kim YJ, Gu HJ, Lee HJ. A case of bacteremia caused by Dialister pneumosintes and Slackia exigua in a patient with periapical abscess. Anaerobe. 2016;38:36–38. doi:10.1016/j.anaerobe.2015.11.006

 Web of Science ®Google Scholar

Mannan S, Ahmad T, Naeem A, Patel V. A case of Dialister pneumosintes bacteremia-associated neck and mediastinal abscess. Am J Case Rep. 2021;22:e930559. doi:10.12659/AJCR.930559

 Web of Science ®Google Scholar

Kaiser M, Weis M, Kehr K, Varnholt V, Schroten H, Tenenbaum T. Severe pneumonia and sepsis caused by Dialister pneumosintes in an adolescent. Pathogens. 2021;10(6):733. doi:10.3390/pathogens10060733

 Web of Science ®Google Scholar

Rousée JM, Bermond D, Piémont Y, et al. Dialister pneumosintes associated with human brain abscesses. J Clin Microbiol. 2002;40(10):3871–3873. doi:10.1128/JCM.40.10.3871-3873.2002

 Web of Science ®Google Scholar

Pierre Lepargneur J, Dubreuil L, Levy J. Isolation of Dialister pneumosintes isolated from a bacteremia of vaginal origin. Anaerobe. 2006;12(5–6):274–275. doi:10.1016/j.anaerobe.2006.07.004

 Web of Science ®Google Scholar

Kogure M, Suzuki H, Ishiguro S, et al. Dialister pneumosintes bacteremia caused by dental caries and sinusitis. Intern Med. 2015;54(6):663–667. doi:10.2169/internalmedicine.54.2904

 Web of Science ®Google Scholar