Comparative Analysis of Epidemiological and Clinical Characteristics Between Invasive Candida Infection versus Colonization in Critically Ill Patients in a Tertiary Hospital in Anhui, China

Figures & data

Table 1 PCR primers used in the study

Primers	Primer sequences (5’–3’)	Target species/gene	Amplicon size (bp)	Reference #
ITS1	TCCGTAGGTGAACCTGCGG	Universal fungi/ITS	—	[15]
ITS4	TCCTCCGCTTATTGATATGC
CAL-F	CAAGAAGATCATAACTCAAT	C. albicans/ERG11	~1,600	[17]
CAL-R	CAGAACACTGAATCGAAAGA
CGL-F	ATGTCCACTGAAAACACTTCTTTGG	C. glabrata/ERG11	1,599	[18]
CGL-R	GTACTTTTGTTCTGGATGTCTCTTTTC
CTR-F	GTTTTCTACTGGATCCCATG	C. tropicalis/ERG11	~1,200	[19]
CTR-R	TACATCTGTGTCTACCACC
CPA-F	GCGATAAGAATGCGGCCGCATGGCATTAGTTGATTTAGC	C. parapsilosis/ERG11	1,569	[20]
CPA-R	ATCGTACAGGCATGCTCAGATTACACATGTATCT

Note: ITS is a target commonly used for fungal (including Candida) species identification by DNA sequencing.

Abbreviation: ITS, internal transcribed spacer.

Table 2 Strain-distribution patterns of invasive Candida infection vs colonization

	Patients with invasive Candida infections, n=75 (%)	Patients with Candida colonization, n=58 (%)	P
C. albicans	33 (44)	32 (55.17)	0.201
Non–C. albicans Candida	42 (56)	26 (44.83)
C. glabrata	24 (57.14)	17 (65.38)	0.739
C. tropicalis	11 (26.19)	8 (30.77)	0.886
C. parapsilosis	6 (14.29)	1 (3.85)	0.108
C. krusei	1 (2.38)	0	0.377

Figure 1 Data of the identification of Candida strains obtained from the present research. (A) MALDI-TOF MS analysis of Candida spp. typically involved in the present study. (B) Microscopically analyzed fungal fluorescent staining results of representative Candida spp. cultured on Sabouraud dextrose/chromogenic agar plates.

Abbreviations: CAL, C. albicans; CGL, C. glabrata; CTR, C. tropicalis; CPA, C. parapsilosis; CKR, C. krusei.

Table 3 Comparison of clinical variables of invasive Candida infections vs controls

	Patients with invasive Candida infections, n=75 (%)	Patients without Candida, n=60 (%)	P
Sex
Male	33 (44)	27 (45)	0.908
Female	42 (56)	33 (55)
Age
Mean ± SD (years)	57.83±19.26	50.60±15.56	0.006
0 – 14	3 (4)	0	0.117
15 – 49	21 (28)	31 (51.67)	0.005
50 – 65	21 (28)	19 (31.67)	0.643
>65	30 (40)	10 (16.67)	0.003
Hospital stay^a
Mean ± SD (days)	44.44±45.46	16.95±13.17	<0.001
0 – 7	4 (5.33)	12 (20)	0.009
7 – 14	22 (29.33)	23 (38.33)	0.270
>14	49 (65.33)	25 (41.67)	0.006
Clinical risk factors
Invasive interventions
Surgical procedures	37 (49.33)	12 (20)	<0.0001
Urethral catheters	34 (45.33)	17 (28.33)	0.043
Ventilatory support	24 (32)	13 (21.67)	0.181
Tracheal intubation	23 (30.67)	14 (23.33)	0.343
Arteriovenous cannulation	21 (28)	17 (28.33)	0.966
Tracheotomy	12 (16)	0	0.001
PD or hemodialysis	3 (4)	5 (8.33)	0.289
Immune state
Immunosuppressive therapy	3 (4)	3 (5)	0.289
Comorbidities
Cancers	18 (24)	5 (8.33)	0.016
Diabetes mellitus	7 (9.33)	7 (11.67)	0.659
Liver cirrhosis	1 (1.33)	0	0.369
Concurrent Candida infections	24 (32)	0	<0.0001
Coinfections of bacteria	49 (65.33)	28 (46.67)	0.029
Clinical outcomes
Improvement	44 (58.67)	54 (90)	<0.0001
Deterioration	8 (10.67)	6 (10)	0.900
Moribund	2 (2.67)	0	0.203

Notes: ^aTotal length of stay for patients with invasive Candida infection or Candida colonization.

Abbreviation: PD, peritoneal dialysis.

Table 4 Comparison of clinical variables of Candida colonization vs controls

	Patients with Candida colonization, n=58 (%)	Patients without Candida, n=60 (%)	P
Sex
Male	41 (70.69)	27 (45)	0.005
Female	17 (29.31)	33 (55)
Age
Mean ± SD (years)	66.12±14.17	50.60±15.56	<0.001
0 – 14	0	0	/
15 – 49	5 (8.62)	31 (51.67)	<0.0001
50 – 65	18 (31.03)	19 (31.67)	0.941
>65	35 (60.34)	10 (16.67)	<0.0001
Hospital stay^a
Mean ± SD (days)	29.55±32.90	16.95±13.17	<0.001
0 – 7 days	1 (1.72)	12 (20)	0.002
7 – 14 days	14 (24.14)	23 (38.33)	0.097
>14 days	43 (74.14)	25 (41.67)	<0.0001
Clinical risk factors
Invasive interventions
Surgical procedures	26 (44.83)	12 (20)	0.004
Urethral catheters	32 (55.17)	17 (28.33)	0.003
Ventilatory support	22 (37.93)	13 (21.67)	0.053
Tracheal intubation	29 (50)	14 (23.33)	0.003
Arteriovenous cannulation	30 (51.72)	17 (28.33)	0.009
Tracheotomy	8 (13.79)	0	0.003
PD or hemodialysis	4 (6.90)	5 (8.33)	0.769
Immune state
Immunosuppressive therapy	3 (5.17)	3 (5)	0.495
Comorbidities
Cancers	27 (46.55)	5 (8.33)	<0.0001
Diabetes mellitus	9 (15.52)	7 (11.67)	0.541
Liver cirrhosis	2 (3.45)	0	0.147
Concurrent Candida infections	9 (15.52)	0	0.001
Coinfections of bacteria	42 (72.41)	28 (46.67)	0.004
Clinical outcomes
Improvement	40 (68.97)	54 (90)	0.005
Deterioration	2 (3.45)	6 (10)	0.157
Moribund	1 (1.72)	0	0.307

Notes: ^aTotal length of hospital stay for patients with invasive Candida infection or Candida colonization.

Abbreviation: PD, peritoneal dialysis.

Table 5 Comparison of clinical variables of invasive Candida infection vs colonization

	Patients with Invasive Candida Infections, n=75 (%)	Patients with Candida Colonization, n=58 (%)	P
Sex
Male	33 (44)	41 (70.69)	0.002
Female	42 (56)	17 (29.31)
Age
Mean ± SD (years)	57.83±19.26	66.12±14.17	0.007
0 – 14	3 (4)	0	0.123
15 – 49	21 (28)	5 (8.62)	0.005
50 – 65	21 (28)	18 (31.03)	0.703
>65	30 (40)	35 (60.34)	0.020
Hospital stay^a
Mean ± SD (days)	44.44±45.46	29.55±32.90	0.037
0 – 7	4 (5.33)	1 (1.72)	0.278
7 – 14	22 (29.33)	14 (24.14)	0.504
>14	49 (65.33)	43 (74.14)	0.276
Clinical risk factors
Invasive interventions
Surgical procedures	37 (49.33)	26 (44.83)	0.606
Urethral catheters	34 (45.33)	32 (55.17)	0.260
Ventilatory support	24 (32)	22 (37.93)	0.476
Tracheal intubation	23 (30.67)	29 (50)	0.023
Arteriovenous cannulation	21 (28)	30 (51.72)	0.005
Tracheotomy	12 (16)	8 (13.79)	0.724
PD or hemodialysis	3 (4)	4 (6.90)	0.458
Immune state
Immunosuppressive therapy	3 (4)	3 (5.17)	0.747
Comorbidities
Cancers	18 (24)	27 (46.55)	0.006
Diabetes mellitus	7 (9.33)	9 (15.52)	0.277
Liver cirrhosis	1 (1.33)	2 (3.45)	0.415
Concurrent Candida infections	24 (32)	9 (15.52)	0.029
Coinfections of bacteria	49 (65.33)	42 (72.41)	0.384
Clinical outcomes
Improvement	44 (58.67)	40 (68.97)	0.222
Deterioration	8 (10.67)	2 (3.45)	0.117
Moribund	2 (2.67)	1 (1.72)	0.717

Notes: ^aTotal length of stay for patients with invasive Candida infection or Candida colonization.

Abbreviation: PD, peritoneal dialysis.

Table 6 Antifungal-sensitivity patterns of patients with invasive Candida infection and colonization

Strain	Antifungal drug	Patients with invasive Candida infections				Patients with Candida Colonization				P^a
		Sensitivity n (%)	MIC (μg/mL)			Sensitivity n (%)	MIC (μg/mL)
			Range	MIC50	MIC90		Range	MIC50	MIC90
C. albicans	AmB	33 (100)	0.50–1.00	0.50	0.50	32 (100)	0.50–1.00	0.50	0.50	/
	FC	33 (100)	4.00–4.00	4.00	4.00	32 (100)	4.00–4.00	4.00	4.00	/
	Flu	31 (93.90)	0.50–64.00	1.00	2.00	32 (100)	0.50–8.00	1.00	2.00	0.038
	Vrc	33 (100)	0.06–1.00	0.06	0.06	32 (100)	0.06–0.50	0.06	0.13	/
	Itr	31 (93.90)	0.12–2.00	0.13	0.13	32 (100)	0.12–0.25	0.13	0.13	0.038
C. glabrata	AmB	24 (100)	0.50–0.50	0.50	0.50	17 (100)	0.50–0.50	0.50	0.50	/
	FC	24 (100)	1.00–4.00	4.00	4.00	16 (94.10)	4.00–16.00	4.00	4.00	0.038
	Flu	24 (100)	1.00–4.00	1.00	4.00	17 (100)	1.00–8.00	2.00	8.00	/
	Vrc	23 (95.80)	0.06–2.00	0.06	0.25	17 (100)	0.06–0.50	0.06	0.50	0.130
	Itr	19 (79.20)	0.12–0.50	0.13	0.50	9 (52.90)	0.12–2.00	0.13	1.00	<0.001
C. tropicalis	AmB	11 (100)	0.50–1.00	0.50	1.00	8 (100)	0.50–1.00	0.50	1.00	/
	FC	11 (100)	4.00–4.00	4.00	4.00	8 (100)	4.00–4.00	4.00	4.00	/
	Flu	7 (63.60)	0.50–128.00	2.00	64.00	7 (87.50)	1.00–64.00	1.00	64.00	<0.001
	Vrc	9 (81.80)	0.06–8.00	0.13	4.00	7 (87.50)	0.06–4.00	0.06	4.00	0.314
	Itr	6 (54.50)	0.12–4.00	0.13	2.00	7 (87.50)	0.12–2.00	0.13	2.00	<0.001
C. parapsilosis	AmB	6 (100)	0.50–0.50	0.50	0.50	1 (100)	/	0.50	0.50	/
	FC	6 (100)	4.00–4.00	4.00	4.00	1 (100)	/	4.00	4.00	/
	Flu	5 (83.30)	1.00–64.00	4.00	64.00	1 (100)	/	4.00	4.00	/
	Vrc	5 (83.30)	0.06–2.00	0.06	2.00	1 (100)	/	0.13	0.13	/
	Itr	4 (66.70)	0.12–0.50	0.13	0.50	1 (100)	/	0.13	0.13	/
C. krusei	AmB	1 (100)	/	0.50	0.50	/	/	/	/	/
	FC	1 (100)	/	4.00	4.00	/	/	/	/	/
	Flu	/	/	/	/	/	/	/	/	/
	Vrc	1 (100)	/	0.06	0.06	/	/	/	/	/
	Itr	/	/	/	/	/	/	/	/	/

Notes: ^aComparisons of the indicated antifungal sensitivities between the two cohorts in terms of the percentage of Candida strains, except colonized C. parapsilosis and C. krusei.

Abbreviations: AmB, amphotericin B; FC, 5-fluorocytosine; Flu, fluconazole; Vrc, voriconazole; Itr, itraconazole; MIC, minimum inhibitory concentration.

Figure 2 Data of homologous 3D-structure modeling for putatively mutant ERG11 gene products in Candida spp. assisted by 5JLC as template (http://www.pdb.org). Presumably altered 3D steric conformations of ERG11 enzymes from azole-resistant C. albicans (A), C tropicalis (B), and C. parapsilosis (C) are shown. Red spots indicate mutation sites at the amino-acid level in each Candida spp. resistant against azoles when compared with corresponding reference sequences in GenBank.

Abbreviations: CAL, C. albicans; CTR, C. tropicalis; CPA, C. parapsilosis.

Odabasi Z, Mert A. Candida urinary tract infections in adults. World J Urol. 2020;38(11):2699–2707. doi:10.1007/s00345-019-02991-5

 PubMed Web of Science ®Google Scholar

Ewig S, Schlochtermeier M, Goke N, Niederman MS. Applying sputum as a diagnostic tool in pneumonia: limited yield, minimal impact on treatment decisions. Chest. 2002;121(5):1486–1492. doi:10.1378/chest.121.5.1486

 Web of Science ®Google Scholar

Zhang L, Xiao M, Wang H, et al. Yeast identification algorithm based on use of the Vitek MS system selectively supplemented with ribosomal DNA sequencing: proposal of a reference assay for invasive fungal surveillance programs in China. J Clin Microbiol. 2014;52(2):572–577. doi:10.1128/JCM.02543-13

 PubMed Web of Science ®Google Scholar

Clinical and Laboratory Standards Institute. Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts. 3rd ed. Wayne (PA): Clinical and Laboratory Standards Institute; 2008.

 Google Scholar

Feng W, Yang J, Ma Y, et al. The effects of secreted aspartyl proteinase inhibitor ritonavir on azoles-resistant strains of Candida albicans as well as regulatory role of SAP2 and ERG11. Immun Inflamm Dis. 2021;9(3):667–680. doi:10.1002/iid3.415

 PubMed Web of Science ®Google Scholar