In vitro Studies of Non-Diphtheriae Corynebacterium Isolates on Antimicrobial Susceptibilities, Drug Resistance Mechanisms, and Biofilm Formation Capabilities

Figures & data

Table 1 Primers for Analysis of Resistance Genes Used in This Study

Target Genes	Related Resistance	Primers	DNA Sequence (5’–3’)	Tm (°C)	Size (bp)	Reference
erm(X)	Erythromycin, Clidamycin	erm(X)-F	AACCATGATTGTGTTTCTGAACG	57	560	[24]
		erm(X)-R	ACCAGGAAGCGGTGCCCT
erm(B)	Erythromycin, Clidamycin	erm(B)-F	GAAAAGGTACTCAACCAAATA	52	639	[24]
		erm(B)-R	AGTAACGGTACTTAAATTGTTTAC
mef(A-E)	Erythromycin, Clidamycin	mef(A-E)-F	GCAAATGGTGTAGGTAAGACAACT	52	399	[24]
		mef(A-E)-R	TAAAACAAATGTAGTGTACTA
aac(3)-XI	Gentamicin	aac(3)-XI-F	ATGACTACAACCAACGAGATC	52	452	[25]
		aac(3)-XI-R	CTAAAGCTCCCGGATGTAGAG
bla	Penicillin, Cefotaxime	bla-F	CAGTCTAGCCACTTCGCCAAT	55	808	[22]
		bla-R	TGACTGCACGGATGGAGATGG
ampC	Penicillin, Cefotaxime	ampC-F	CAATCGGATTCCTGGTCGCT	55	965	[22,26]
		ampC-R	TGGTTCGCGTGATGTTTTCG
gyrA	Ciprofloxacin	gyrA-F	GCGGCTACGTAAAGTCC	60	337	[27]
		gyrA-R	CCGCCGGAGCCGTTCAT
tetA	Tetracycline	tetA-F	TTAGCGTTCGGCGACCTGG	60	552	[28]
		tetA-R	GGTGGTCTTGTCTGCCCTCA
tetB	Tetracycline	tetB-F	ACGGTGTTCAACGCCCTGTT	59	506	[28]
		tetB-R	AACTGGGTGCCTTCAGGGTC
rpoB	Rifampin	rpoB-F	CTGATCCAGAACCAGGTCCG	55	811	[28,29]
		rpoB-R	GACGTACTCCACCACACCAG

Figure 1 Biofilm formation capabilities of different species of non-diphtheriae Corynebacterium isolates. **P<0.01 and ***P<0.001 vs the negative control.

Abbreviations: NEG, negative control; POS, positive control.

Table 2 Demographic and Clinical Characteristics of Non-Diphtheriae Corynebacterium Isolates

Patient Characteristics	C. striatum(n=15)	C. glucuronolyticum (n=9)	C. urealyticum (n=8)	C. tuberculostearicum (n=4)	C. jeikeium (n=4)	C. amycolatum (n=5)	P value
	Median (P25, P75)	Median (P25, P75)	Median (P25, P75)	Median (P25, P75)	Median (P25, P75)	Median (P25, P75)
Age median (P25, P75)	68 (56, 91)	32 (30, 54)	46 (37, 64)	77 (57, 94)	54 (36, 93)	71 (67, 77)	0.011
Range (years)	4–93	6–85	35–64	57–101	36–95	48–94
≤30	1 (6.7%)	2 (22.2%)	0	0	0	0
30–40	1 (6.7%)	4 (44.4%)	2 (25.0%)	0	1 (25.0%)	1 (20.0%)
40–50	0	0	3 (37.5%)	0	0	0
50–60	4 (26.7%)	1 (11.1%)	1 (12.5%)	1 (25.0%)	1 (25.0%)	0
>60	9 (60.0%)	2 (22.2%)	2 (25.0%)	3 (75.0%)	2 (50.0%)	4 (80.0%)
Male, %	13 (86.7%)	8 (88.9%)	5 (62.5%)	3 (75.0%)	4 (100%)	2 (40.0%)	0.174
Admission Diagnosis
Renal calculi	5 (33.3%)	1 (11.1%)	0	1 (25.0%)	0	0	0.210
Ureteral calculi	0	4 (44.4%)	7 (87.5%)	0	0	1 (20.0%)	0.0001
Renal diseases except calculi	1 (6.7%)	0	0	1 (25.0%)	0	1 (20.0%)	0.405
Urinary tract infection	2 (13.3%)	1 (11.1%)	1 (12.5%)	0	3 (75.0%)	0	0.027
Hydronephrosis	1 (6.7%)	1 (11.1%)	0	0	0	0	0.836
Cardiovascular diseases	2 (13.3%)	0	0	0	0	1 (20.0%)	0.509
Malignancy	3 (20.0%)	1 (11.1%)	0	1 (25.0%)	1 (25.0%)	1 (20.0%)	0.784
Edema	0	1 (11.1%)	0	1 (25.0%)	0	1 (20.0%)	0.326
Dementia	1 (6.7%)	0	0	0	0	0	0.843

Table 3 Antimicrobial Susceptibilities of 45 Non-Diphtheriae Corynebacterium Against ten Antimicrobial Agents

Antibiotics	MIC range (μg/mL)	All Corynebacterium spp. (n=45)			C. sriatum (n=15)			C. glucuronolyticum (n=9)			C. urealyticum (n=8)			C. tuberculostearicum (n=4)			C. jeikeium (n=4)			C. amycolatum (n=5)
		MIC50	MIC90	R%	MIC50	MIC90	R%	MIC50	MIC90	R%	MIC50	MIC90	R%	MIC50	MIC90	R%	MIC50	MIC90	R%	MIC50	MIC90	R%
Penicillin	≤0.12 to ≥4	64	>64	66.7	>32	>32	80.0	2	8	22.2	32	>64	75.0	64	>128	100	>64	>64	100	2	>64	40.0
Cefotaxime	≤1 to ≥4	8	>64	53.3	>64	>64	80.0	<1	<1	0	2	>64	50.0	16	64	75.0	>64	>64	100	2	>64	20.0
Gentamicin	≤4 to ≥16	8	32	22.2	4	8	6.7	4	32	22.2	16	64	50.0	<4	<16	0	4	>64	50.0	32	32	20.0
Erythromycin	≤0.5 to ≥2	>64	>64	93.3	>64	>64	86.7	>64	>64	88.9	>32	>32	100	>32	>32	100	>32	>32	100	>32	>32	100.0
Ciprofloxacin	≤1 to ≥4	32	>64	93.3	32	64	93.3	32	>64	100	32	64	87.5	4	32	75.0	32	>64	100	16	>64	100.0
Tetracycline	≤4 to ≥16	<4	64	37.8	4	64	33.3	32	64	77.8	16	32	37.5	<4	<4	0	4	>64	25.0	16	32	20.0
Clindamycin	≤0.5 to ≥4	16	>64	91.1	16	>64	80.0	>64	>64	88.9	>64	>64	87.5	16	>64	100	16	>64	100	16	>64	100.0
Rifampin	≤1 to ≥4	<1	32	13.3	1	4	13.3	<1	<1	0	<1	8	12.5	<4	16	50.0	<1	32	25.0	<1	<4	0.0
Linezolid	≤2	1	2	0	0.5	0.5	0	0.5	2	0	0.12	1	0	2	2	0	1	2	0	1	1	0.0
Vancomycin	≤2	<0.12	0.5	0	0.5	0.5	0	0.5	0.5	0	<0.12	<0.12	0	<0.12	<0.12	0	<0.12	<0.12	0	<0.12	<0.12	0.0

Notes: R%: Resistance Rate.

Table 4 Drug-Resistant Gene Profiles of Non-Diphtheriae Corynebacterium Isolates

Species	No.	Prevalence	Drug Resistance Genes
			erm(X)	aac(3)-XI	bla	ampC	gyrA	tetA	tetB	rpoB
C. striatum	15	33.3%	+	+	+	+	+	+	+	+
C. glucuronolyticum	9	20.0%	+	+	+	-	+	+	+	+
C. urealyticum	8	17.8%	+	+	+	-	+	+	+	+
C. tuberculostearicum	4	8.9%	+	+	+	-	+	-	+	+
C. jeikeium	4	8.9%	+	-	+	-	+	-	+	+
C. amycolatum	5	11.1%	+	-	+	-	+	+	+	+
Total	45	100.0%	41 (91.1%)	29 (64.4%)	20 (44.4%)	14 (31.1%)	45 (100%)	11 (24.4%)	31 (68.9%)	45 (100%)

Table 5 Amino Acid Substitutions in gyrA Gene Associated with Resistance to Quinolones in the Non-Diphtheriae Corynebacterium Isolates

Species (Total No.)	No. of Ciprofloxacin-Resistant Isolates	Amino Acid Substitutions of gyrA Gene
		Position 87	Position 91
C. striatum (15)	8	Ser→Val	Asp
	6	Ser→Phe	Asp→Ala
C. glucuronolyticum (9)	6	Ser→Tyr	Asp
	3	Ser→Tyr	Asp→Ala
C. urealyticum (8)	5	Ser→Tyr	Asp→Ala
	2	Ser→Val	Asp→Tyr
C. tuberculostearicum (4)	3	ND	ND
C. jeikeium (4)	2	Ser→Ile	Asp
	2	Ser→Ile	Asp→Tyr
C. amycolatum (5)	5	Ser→Arg	Asp
Total (45)	42

Abbreviation: ND, not detected.

Clinical and Laboratory Standards Institute. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria CLSI Document M45. 3rd ed. Wayne: CLSI; 2015.

 Google Scholar

Magiorakos AP, Srinivasan A, Carey RB, et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 2012;18(3):268–281. doi:10.1111/j.1469-0691.2011.03570.x

 PubMed Web of Science ®Google Scholar

Hoefer A, Pampaka D, Herrera-Leon S, et al. Molecular and epidemiological characterization of toxigenic and nontoxigenic Corynebacterium diphtheriae, Corynebacterium belfantii, Corynebacterium rouxii, and Corynebacterium ulcerans isolates identified in Spain from 2014 to 2019. J Clin Microbiol. 2021;59(3). doi:10.1128/JCM.02410-20

 Web of Science ®Google Scholar

Alibi S, Ferjani A, Boukadida J, et al. Occurrence of Corynebacterium striatum as an emerging antibiotic-resistant nosocomial pathogen in a Tunisian hospital. Sci Rep. 2017;7(1):9704. doi:10.1038/s41598-017-10081-y

 PubMed Web of Science ®Google Scholar

Chapartegui-Gonzalez I, Fernandez-Martinez M, Rodriguez-Fernandez A, et al. Antimicrobial susceptibility and characterization of resistance mechanisms of Corynebacterium urealyticum clinical isolates. Antibiotics. 2020;9(7):404. doi:10.3390/antibiotics9070404

 Web of Science ®Google Scholar

Ramos JN, Valadao TB, Baio P, et al. Novel mutations in the QRDR region gyrA gene in multidrug-resistance Corynebacterium spp. isolates from intravenous sites. Antonie Van Leeuwenhoek. 2020;113(4):589–592. doi:10.1007/s10482-019-01353-w

 Web of Science ®Google Scholar

Ramos JN, Souza C, Faria YV, et al. Bloodstream and catheter-related infections due to different clones of multidrug-resistant and biofilm producer Corynebacterium striatum. BMC Infect Dis. 2019;19(1):672. doi:10.1186/s12879-019-4294-7

 Web of Science ®Google Scholar