Performance of Two Matrix-Assisted Laser Desorption Ionization–Time-of-Flight Mass Spectrometry (MALDI-TOF MS) Systems for Identification of the Viridans Group Streptococci

Figures & data

Table 1 Sequences of Oligonucleotides Used in This Study

Primers	Sequence (5’-3’)	Product Size (bp)
tuf forward	TTGGTTGAAATGGAAATCCGTG	514
tuf reverse	GTCCACCTTCTTCTTTAGTAAG
rpoB forward	CCAAACGTYGGKGAAGATGC	705
rpoB reverse	TGIARTTTRTCATCAACCATGTG

Table 2 Identified Accuracy Rate of Streptococci by Two MALDI-TOF Systems

Alpha-Hemolytic Streptococci	Number of Strains	VITEK MS		Bruker Biotyper
		No.	%	No.	%
S. pneumoniae	84	84	100	79	94
S. anginosus group	91	91	100	88	96.7
S. mitis group	80	75	93.8	68	85
S. bovis group^a	11	11	100	8	72.7
S. salivarius group	10	0	0	5	50
S. mutans group	1	1	100	1	100
Total	214	201	93.9	191	89.3

Note: ^aS. bovis group included S. gallolyticus ssp. pasteurianus.

Figure 1 The molecular phylogenetic tree of viridans group streptococci isolates based on tuf gene. The evolutionary history was inferred by using the Neighbor-Joining method. The optimal tree with the sum of branch length = 5.29069834 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Maximum Composite Likelihood method² and are in the units of the number of base substitutions per site. Evolutionary analyses were conducted in MEGA7. The length of the compared sequences was 506 bp.

Table 3 Identification Results of MALDI-TOF Systems for Alpha-Hemolytic Streptococci

Alpha-Hemolytic Streptococci	Species	No.	VITEK MS^a				Bruker Biotyper^b
			High-Confidence Result	Low-Confidence Result	No Result	Error Result	High-Confidence Result	Low-Confidence Result	No Result	Error Result
S. pneumoniae	S. pneumoniae	84	84	0	0	0	79	2	2	1
S. anginosus group	S. anginosus	65	65	0	0	0	62	3	0	0
	S. constellatus	21	21	0	0	0	21	0	0	0
	S. intermedius	5	5	0	0	0	5	0	0	0
S. mitis group	S. mitis	53	51	1	0	1	45	3	0	5
	S. oralis	20	17	0	2	1	18	2	0	0
	S. gordonii	3	3	0	0	0	2	1	0	0
	S. parasanguinis	3	3	0	0	0	2	1	0	0
	S. sanguinis	1	1	0	0	0	1	0	0	0
S. bovis group	S. gallolyticus ^c	11	11	0	0	0	8	2	0	1
S. salivarius group	S. salivarius	10	0	10	0	0	5	3	1	1
S. mutans group	S. mutans	1	1	0	0	0	1	0	0	0
Total		277	262	11	2	2	249	17	3	8

Notes: ^aFor VITEK MS, high-confidence and low-confidence results were defined with confidence values above 99% and between 60 and 99%, respectively, and no result is obtained when the confidence value is below 60%; ^bFor Bruker Biotyper, scores ≥2 and >1.7 stand for high- and low-confidence results, respectively, and scores ≤1.7 for no result; ^cS. gallolyticus included subspecies pasteurianus.

Table 4 Error Identification of Streptococci by Two MALDI-TOF MS Systems

Isolates No.	Sequence Analysis	Optochin	Bile Solubility	MALDI-TOF MS	Misidentification	Score
SNP9	S. mitis	R	–	VITEK MS	S. parasanguinis	99.9
L0124327	S. oralis	R	–	VITEK MS	S. pneumoniae	99.9
S289	S. pneumoniae	S	+	Bruker Biotyper	K. aerogenes	1.896
SNP9	S. mitis	R	–	Bruker Biotyper	S. pneumoniae	2.227
6	S. mitis	R	–	Bruker Biotyper	S. pneumoniae	1.775
201,685	S. mitis	R	–	Bruker Biotyper	S. oralis	2.244
63	S. mitis	R	–	Bruker Biotyper	S. oralis	2.364
48	S. mitis	R	–	Bruker Biotyper	S. anginosus	2.345
19	S. gallolyticus	R	–	Bruker Biotyper	E. coli	2.287
47	S. salivarius	R	–	Bruker Biotyper	S. pneumoniae	2.295

Zhao W, Pan F, Wang B, et al. Epidemiology characteristics of Streptococcus pneumoniae from children with pneumonia in Shanghai: a retrospective study. Front Cell Infect Microbiol. 2019;9:258. doi:10.3389/fcimb.2019.00258

 PubMed Web of Science ®Google Scholar