Clinical and Molecular Profile of Carbapenem Resistant Klebsiella pneumoniae Infections in a Tertiary Care Hospital –Mangalore

Figures & data

Table 1 Primers and Probes Used in the Multiplex, Real-Time PCR Test

Gene	Primer Names	Probe	Sequences (5’-3’)	Wavelength (nm)
blaNDM	NDM Carbapenemase	FAM labeled hydrolysis probe	F: GGTTTGGCGATCTGGTTTTC R: CGGAATGGCTCATCACGATC	FAM (465–510)
blaKPC	KPC Carbapenemase	HEX labeled hydrolysis probe	F: ATGTCACTGTATCGCCGTCT R: TTTTCAGAGCCTTACTGCCC	610 (540–610)
blaIMP	IMP Carbapenemase	Texas Red labelled hydrolysis probe	F: GAATAGRRTGGCTTAAYTCTC R: CCAAACYACTASGTTATC	640 (610–645)
blaOXA	OXA-48 Carbapenemase	Texas Red labeled hydrolysis probe	F: TTGGTGGCATCGATTATCGG R: GAGCACTTCTTTTGTGATGGC	640 (610–645)
blaVIM	VIM Carbapenemase	Cyan500 labeled hydrolysis probe	F: GTTTGGTCGCATATCGCAAC R: AATGCGCAGCACCAGGATAG	FAM (465–510)

Abbreviations: NDM, New Delhi metallo β-lactamases; KPC, Klebsiella pneumoniae carbapenemases; IMP, Active on imipenem metallo β-lactamases; VIM, Verona integron-encoded metallo β-lactamases; OXA-48, Oxacillinase-48-like carbapenemases.

Table 2 Composition of Master Mix for Detecting blaNDM, blaKPC, blaVIM, blaIMP, and blaOXA48gene

Components	Product Code	Volume to be Added for 1R (for a 25 µL Reaction)
		CRG1 Tube	CRG2 Tube
Hi-Quanti 2X Realtime PCR Master Mix	MBT180	12.5 µL	12.5 µL
CRG1 Primer-Probe Mix	DS0949	4 µL	–
CRG2 Primer-Probe Mix	DS0950	–	4 µL
Internal Control Primer-Probe Mix	DS0498	1 µL	1 µL
Internal Control B DNA	DS0385A	1 µL	1 µL
Molecular Biology Grade Water for PCR	ML065	1.5 µL	1.5 µL
Positive Control / Negative Control / Template DNA	–	5 µL	5 µL
Total volume	–	Upto 25 µL	Upto 25 µL

Figure 1 Distribution of CRKP isolates in various departments of hospital.

Figure 2 Distribution of CSKP isolates in various departments of hospital.

Table 3 Comparison of Clinical Characteristics of CSKP and CRKP Isolates by Univariate Analysis

Variables	CRKP (536) n%	CSKP (250) n%	TOTAL	OR (95% C.I)	P
Smoking	22 (4.1)	19 (7.6)	41	0.52 (0.276–0.980)	0.04
Alcohol	24 (4.5)	18 (7.2)	42	0.60 (0.322–1.135)	0.114
Diabetes	311 (58.0)	66 (26.4)	377	3.853 (2.772–5.357)	0.001
Poor glycemic control	270 (50.4)	57 (22.8)	327	3.437 (2.445–4.831)	0.001
Hypertension	240 (44.8)	43 (17.2)	283	3.903 (2.696–5.651)	0.001
COPD	93 (17.4)	23 (9.2)	116	2.072 (1.277–3.361)	0.003
Asthma	52 (9.7)	17 (6.8)	69	1.473 (0.833–2.602)	0.181
TB	16 (3.0)	26 (10.4)	42	0.265 (0.139–0.504)	0.001
Immunosuppression	156 (29.1)	20 (8.0)	176	4.721 (2.882–7.733)	0.001
CKD	209 (39.0)	43 (17.2)	252	3.077 (2.122–4.461)	0.001
CLD	29 (5.4)	11 (4.4)	40	1.243 (0.61–2.53)	0.548
Cardiovascular disease	195 (36.4)	29 (11.6)	224	4.358 (2.848–6.667)	0.001
Pulmonary disease	212 (39.6)	106 (42.4)	318	0.889 (0.655–1.206)	0.449
Neurological disease	53 (9.9)	24 (9.6)	77	1.033 (0.622–1.716)	0.899
Autoimmune disease	16 (3.0)	9 (3.6)	25	0.824 (0.359–1.891)	0.647
Prior history of surgery	321 (59.9)	72 (28.8)	393	3.691 (2.67–5.102)	0.001
Tumour	32 (6.0)	9 (3.6)	41	1.7 (0.799–3.618)	0.164
Use of broad spectrum antibiotics	310 (57.8)	45 (18.0)	355	6.249 (4.336–9.005)	0.001
Previous hospitalizations	323 (60.3)	49 (19.6)	372	6.22 (4.353–8.889)	0.001
Urinary Catheter	329 (61.38)	106 (42.4)	435	2.159 (1.591–2.93)	0.001
Central venous catheter	92 (17.2)	20 (8.0)	112	2.383 (432–3.965)	0.001
Nasogastric insertion	281 (52.4)	82 (32.8)	363	2.258 (1.65–3.09)	0.001
Parenteral nutrition	216 (40.3)	64 (25.6)	280	1.962 (1.407–2.735)	0.001
Outcome factors
ICU admission	160 (29.9)	34 (13.6)	194	2.703 (1.801–4.058)	0.001
SOFA’s >12	121 (22.6)	20 (8.0)	141	3.353 (2.034–5.527)	0.001
Mechanical ventilation	143 (26.7)	20 (8.0)	163	4.184 (2.55–6.867)	0.001
Septic shock	86 (16.0)	6 (2.4)	92	7.772 (3.348–18.041)	0.001
Recovered	305 (56.9)	205 (82.0)	510	0.29 (0.201–0.418)	0.001
DAMA	134 (25.0)	35 (14.0)	169	2.048 (1.363–3.077)	0.001
Mortality	97 (18.1)	10 (4.0)	107	5.303 (2.714–10.36)	0.001

Notes: P<0.05 is significant (if P<0.05 [0.02–0.05]=95%; P<0.01 [0.002–0.01]=99%; P<0.001 [0.000–0.001]=99.9%).

Abbreviations: CRKP, Carbapenem resistant K. pneumoniae isolates; CSKP, Carbapenem susceptible K. pneumoniae isolates; COPD, Chronic obstructive pulmonary disease; CKD, Chronic Kidney Disease; CLD, Chronic Liver Disease; SOFA’s, Sequential organ failure assessment; ICU, Intensive Care Unit; DAMA, Discharged against medical advice.

Table 4 Multivariate Analysis of Factors Influencing the Acquisition of Carbapenem Resistance in K. pneumoniae Isolates

Variables	OR	95% CI	P
Diabetes	3.160	2.008–4.971	0.001
Hypertension	3.412	2.132–5.461	0.001
COPD	3.193	1.620–6.294	0.001
Immunosuppression	4.369	2.305–8.282	0.001
Cardiovascular disease	2.386	1.326–4.293	0.004
Prior history of surgery details	2.263	1.436–3.566	0.001
Use of broad spectrum antibiotics	1.804	0.943–3.453	0.075
Previous hospitalizations	4.314	2.240–8.308	0.001
Central venous catheter	0.521	0.242–1.121	0.095
Parenteral nutrition	0.284	0.154–0.521	0.001
Septic shock	3.627	1.229–10.706	0.020
Recovered	0.487	0.268–0.885	0.018

Notes: P<0.05 is significant (if P<0.05 [0.02–0.05]=95%; P<0.01 [0.002–0.01]=99%; P<0.001 [0.000–0.001]=99.9%).

Abbreviations: OR, Odds ratio; CI, Confidence interval.

Figure 3 Antibiotic susceptibility pattern of CRKP (Carbapenem resistant K.pneumoniae) isolates.The interpretation of the results was according to the Clinical and Laboratory Standards Institute guidelines, CLSI(2020).

Figure 4 Antibiotic susceptibility pattern of CSKP (Carbapenem susceptible K. pneumoniae) isolates.The interpretation of the results was according to the Clinical and Laboratory Standards Institute guidelines, CLSI(2020).

Table 5 Determination of Meropenem MIC by Broth Micro-Dilution Method

Antibiotic	MIC Concentrations (µg/mL)
	0.12	0.25	0.5	01	02	04	08	16	32	64	128	256
Meropenem	–	–	–	–	–	145(27.5%)	260(48.5%)	67(12.5%)	28(5.2%)	18(3%)	8(1.5%)	10(1.8%)

Notes: The MIC of meropenem determined by Broth Micro-Dilution Method in CRKP(536) isolates. The numeric in the bracket represents the percentage of K. pneumoniae strains.

Table 6 Multiplex Quantitative Real-Time PCR Assay for the CRKP Isolates Carrying Carbapenemase Genes

PCR Set	Carbapenemase Genes	No of Carbapenemase Genes	Ct value(Mean)
1	blaNDM-1	175	17
	blaKPC	0	Not detected
	blaIMP	0	Not detected
	blaVIM	0	Not detected
2	blaOXA-48	140	15.2

Notes: Shown are Cycle threshold value (mean). PCR set 1 targets blaNDM, blaKPC, blaVIM, and blaIMP, while PCR set 2 targets blaOXA48. C_t value less than 40 considered as positive for both blaNDM-1 and blaOXA-48 like.

Figure 5 Real-time PCR amplification results for blaNDM-1 (A), blaOXA-48 (B), and coexistence of blaOXA48 and blaNDM-1 (C) obtained after 45 cycles on the SLAN-96P Real time PCR system. C_t value ≤40 is considered positive for blaNDM-1 and blaOXA-48 genes.

Table 7 Distribution of Carbapenemases Genes Among Isolates of K. pneumoniae from Various Sources

SI No	Source	blaOXA-48 (N=140)	blaNDM-1 (N=175)	blaOXA48+ blaNDM1 (115)
1	Sputum	65 (47.4%)	50 (36.4%)	22 (16%)
2	Pus /Swab	32 (22.8%)	70 (50%)	38 (27.2%)
3	Urine	33 (29%)	26 (23%)	55 (48%)
4	Blood	10 (29%)	25 (71%)	–
5	ET aspirate	–	4 (100%)	–

Note: Data presented as n (%).

Abbreviations: blaOXA-48, Oxacillinase; blaNDM-1, New Delhi metallo-beta -lactamase; ET aspirates, Endotracheal.