Direct sequencing for rapid detection of multidrug resistant Mycobacterium tuberculosis strains in Morocco

Figures & data

Table 1 Primers for polymerase chain reaction amplification

Gene	Size	Primer	Sequence	Temperature (°C)
rpoB^Citation21	123	TR8	TGCACGTCGCGGACCTCCA	58
		TR9	TCGCCGCGATCAAGGAGT
katG^Citation27	419	RTB 59	TGGCCGCGGCGGTCGACATT	62
		RTB 38	GGTCAGTGGCCAGCATCGTC
inhA promoter^Citation27	246	inhA P5	CGCAGCCAGGGCCTCGCTG	60
		inhA P3	CTCCGGTAACCAGGACTGA

Table 2 Frequency of mutations identified by sequencing in the katG and rpoB genes of multidrug-resistant Mycobacterium tuberculosis isolates

Gene	Position	Type of mutation	Amino acid change	Frequency	Total
rpoB	513	Substitution of CAA → CCA	Glutamine → Proline	1 (3.8%)	26
	513	Substitution of GAA → CTA	Glutamine → Leucine	1 (3.8%)
	516	Substitution of GAC → GTC	Aspartate → Valine	2 (7.7%)
	516	Substitution of GAC → TAC	Aspartate → Tyrosine	2 (7.7%)
	516	Substitution of GAC → CAC	Aspartate → Histidine	1 (3.8%)
	518	Deletion of AAC		2 (7.7%)
	520	Deletion of CCG		1 (3.8%)
	526	Substitution of CAC → CGC	Histidine → Arginine	1 (3.8%)
	526	Substitution of CAC → AGC	Histidine → Serine	1 (3.8%)
	527	Substitution of AAG → CAG	Lysine → Glutamine	1 (3.8%)
	531	Substitution of TCG → TGG	Serine → Tryptophan	1 (3.8%)
	531	Substitution of TCG → TTG	Serine → Leucine	12 (46%)
katG	315	Substitution of AGC → ACC	Serine → Threonine	15 (93.75%)	16
inhA promoter	−15	Substitution of C → T		1 (6.25%)

Table 3 Distribution of MDR according to the tuberculosis profile of patients

TB profile	n	Monoresistant strains		MDR strains
		Isoniazid	Rifampicin
New cases
Smear positive	72	5	12	1
Smear negative	28	0	3	0
Previously treated patients
Chronic	7	0	0	4
Drug relapse	18	1	2	4
Drug failure	8	1	0	0
Total	133	7	17	9

Abbreviation: MDR, multidrug resistance.

Figure 1 Management of suspected and new cases.

Abbreviation: BAAR, bacillus acido-alcohol resistant.

Figure 2 Place of genotypic DST in the global management of TB for specific cases: previously treated patients (chronic, relapse, failure, default), co-infection with HIV, patients with close contact to MDR TB cases.

Abbreviations: MDR, multidrug resistance; DST, drug susceptibility testing; TB, tuberculosis; HIV, Human immunodeficiency virus.

AbdelaalAEl-GhaffarHZaghloulMEl mashadNBadranEFathyAGenotypic detection of rifampicin and isoniazid resistant Mycobacterium tuberculosis strains by DNA sequencing: a randomized trialAnn Clin Microbiol Antimicrob200981419183459

 PubMed Web of Science ®Google Scholar

CingolaniAAntinoriASanguinettiMApplication of molecular methods for detection and transmission analysis of Mycobacterium tuberculosis drug resistance in patients attending a reference hospital in ItalyJ Infect Dis199917941025102910068603

 PubMed Web of Science ®Google Scholar