Sulfur mustard induces expression of metallothionein-1A in human airway epithelial cells

Figures & data

Table 1 Characteristics and pulmonary function test results of SM-injured patient and control group

	Control group subjects n = 15	SM-injured patients n = 24	Pvalue
Age range	22–57	30–58	–
Age (mean ± SD)	43.6 ± 10.92	42.9 ± 5.48	0.83
FVC (mean ± SD)	3.34 ± 0.79	2.87 ± 0.89	0.11
FEV1 (mean ± SD)	2.71 ± 0.81	1.92 ± 0.87	0.007*
FEV1/FVC (mean ± SD)	79.85 ± 6.15	67.88 ± 15.81	0.001*
RV (mean ± SD)	2.38 ± 0.97	3.75 ± 1.75	0.04*

Note:

* P < 0.05.

Abbreviations: FVC, forced vital capacity; FEV₁, forced expiratory volume in 1 second; RV, residual volume; SD, standard deviation.

Table 2 Sequence and features of PCR

Gene (gene bank ID)	Primer sequence (5′ to 3′)	Annealing Tm (°C)	Product size (bp)
MT-1A (NM_005946)
Forward:	ATGGACCCCAACTGCTCCTGC	59	177
Reverse:	CAGCTGCACTTCTCTGATGCCC
β-actin (NM_001101)
Forward:	TTCTACAATGAGCTGCGTGTGG	59	119
Reverse:	GTGTTGAAGGTCTCAAACATGAT

Figure 1 MT-1A gene expression in SM-injured patients and in unexposed control cases. Gene expressions were measured by semiquantitative reverse transcriptase polymerase chain reaction, and were upregulated in SM-injured patients (lanes 3–12). Normal samples (lanes 1 and 2), SM-injured patients samples (lanes 3–13).

Abbreviations: SM, sulfur mustard; M, 100 bp marker; MT, metallothionein.

Table 3 Increases in MT1A expression in sulfur mustard-exposed patients in comparison with control group

Case group/gene	SM-exposed cases vs unexposed cases	P(t-test)
MT-1A	4.0 ± 2.60	0.001*

Figure 2 Immunohistochemical staining for MT-1A protein in bronchial epithelium. Left side micrographs reveal the expression of MT-1A in the basal cell layer of control group airway epithelium (arrow, A and C). Right side micrographs show MT-1A expression in SM-injured airway epithelium (B and D). Note the immunoreactivity of MT-A1 in the control group is higher and wider than in the SM-injured samples. In the high and same magnification the epithelium layer thickness in SM-injured is much thicker than control group (C and D).

Abbreviations: L, airway lumen; Bm, basement membrane; MT, metallothionein; SM, sulfur mustard.