Polymorphisms of the Matrix Metalloproteinase Genes are Associated with Acute Ischemic Stroke in Chinese Han Population

Figures & data

Table 1 PCR Conditions and Primer Sequences

Gene	PCR Conditions	Primer Sequences*
MMP-2-1306T	Pre-denaturation at 96 °C for 1 min	5′- AGACCTGAAGAGCTAAAGAGGT −3′
	Denaturation at 96 °C for 10s
	Annealing at 52 °C for 5s
	Extension at 60 °C for 30s
MMP-3-1612	Pre-denaturation at 95°C for 5 min	F:5′-TTCTCCATTCCTTTGATGGGGGAAAGA-3′
	Denaturation at 94°C for 1 min,
	63°C for 1 min, and 72°C for 1 min
		R:5′-TTATCTGTTGGGCTCCACTGTTTCTTCC-3′
	Extension at 72°C for 10 min.
MMP-9 −1562	Pre-denaturation at 95°C for 5 min	F: 5′-GCC TGG CAC ATA GTA GGC CC-3′
	Denaturation at 94°C for 1 min,
	63°C for 1 min, and 72°C for 1 min
		R: 5′-CTT CCT AGC CAG CCG GCA TC-3′
	Extension at 72°C for 10 min.

Note: *The primer sequence of MMP-2-1306T is used for SNaPshot sequence and the primer sequence of MMP-3-1612 and MMP-3-1612 are used for polymerase chain reaction.

Abbreviations: PCR, polymerase chain reaction; min, minute; s, second; °C, Celsius.

Table 2 Clinical Parameters of Patients and Controls

Clinical Parameters	Patients	Controls	Statistical Analysis	P value
Male / Female (ratio)^b	163/137	145/155	2.162	0.142
Age(years)^a	59.69±12.55	58.69±11.71	1.002	0.317
CHO (mmol/L, x±s)	4.47±1.15	4.42±0.84	0.638	0.524
TG (mmol/L, x±s)	1.70±1.32	1.76±1.61	0.527	0.590
Glu (mmol/L, x±s)	6.37±2.65	5.51±1.72	4.69	<0.01*
HDL (mmol/L, x±s)	1.05±0.43	1.19±0.35	4.402	<0.01*
LDL (mmol/L, x±s)	2.62±1.06	2.67±0.91	0.546	0.586
Hcy (mmol/L, x±s)	17.95±9.09	15.52±6.29	3.806	<0.01*
Number of hypertension (n,%)^b	97 (32.3)	21 (7)	59.34	<0.01*

Notes: ^aPaired t-test; ^bχ² test. *P < 0.05 denotes statistical significance.

Abbreviations: TG, triglyceride; LDL, low-density lipoprotein; HDL, high-density lipoprotein; CHO, cholesterol.

Figure 1 Results of SNaPshot microsequencing and DNA sequencing of MMP-2. (A–C) Results of SNaPshot microsequencing of MMP-2. (A) The results of SNaPshot microsequencing of CC genotype. (B) The results of SNaPshot microsequencing of CT genotype. (C) The results of DNA sequencing of TT genotypes. (D–F) Results of DNA sequencing of MMP-2. (D) The DNA sequencing of the CC genotype of MMP-2. (E) The DNA sequencing of the CT genotype of MMP-2. (F) The DNA sequencing of the TT genotype of MMP-2.

Figure 2 Continued.

Figure 2 Results of electrophoretic map and DNA sequencing of MMP-3,9. (A) The results of electrophoretic map of MMP-3. (B) The results of electrophoretic map of MMP-9. (C–E) Results of DNA sequencing of MMP-3. (C) The results of DNA sequencing of 6A/6A genotype. (D) The results of DNA sequencing of 5A/6A genotype. (E) The results of DNA sequencing of 5A/5A genotype. (F–H) Results of DNA sequencing of MMP-9. (F) The results of DNA sequencing of CC genotype. (G) The results of DNA sequencing of CT genotype. (H) The results of DNA sequencing of TT genotype.

Table 3 Frequencies of MMPs-2,3,9 Genotype and Alleles in Controls and Patients

Gene	Patient (n, %)	Control (n, %)	P value	OR (95% CI)
MMP-2-1306T
Genotypes
CC	240 (80.0)	215 (71.7)
CT	55 (18.3)	70 (23.3)	0.083	0.704 (0.473~1.048)
TT	5 (1.7)	15 (5.0)	0.015*	0.299 (0.107~0.835)
Alleles frequencies
C	535 (89.2)	500 (83.3)
T	65 (10.8)	100 (16.7)	0.003*	0.607 (0.434~0.849)
MMP-3-1612
Genotypes
6A/6A	216 (72.0)	213 (71.0)
5A/6A	39 (25.0)	75 (21.0)	0.414	1.174 (0.799~1.725)
5A/5A	45(3.0)	12 (8.0)	0.011*	0.370 (0.168~0.814)
Alleles frequencies
6A	471(84.5)	501 (81.5)
5A	84 (15.5)	87 (18.5)	0.167	0.808 (0.597~1.093)
MMP-9 −1562
Genotypes
CC	201 (67.0)	221 (73.6)
CT	95 (31.7)	76 (25.3)	0.080	1.374 (0.962~1.964)
TT	4 (1.3)	3 (1.0)	0.617	1.466 (0.324~6.630)
Alleles frequencies
C	497 (82.8)	518 (86.3)
T	103 (17.2)	82 (13.7)	0.093	1.309 (0.955~1.794)

Note: *P < 0.05 denotes statistical significance.

Abbreviation: OR (95% CI), 95% confidence interval of OR value.

Table 4 Compare of MMP-2,3,9 Polymorphism Genotype and Subtype of Cerebral Infarction

Genotype /Alleles	Control (n, %)	LAA			SAO			SOE
		n=117	P value	OR (95% CI)	n=168	P value	OR (95% CI)	n=15	P value	OR (95% CI)
MMP-2-1306T
CC	215 (71.7)	91 (78.3)			137 (81.8)			12 (81.5)
CT	70 (23.3)	24 (19.7)			28 (16.5)			3 (18.5)
TT	15 (5.0)	2 (1.2)			3 (1.7)			0 (0)
CT vs CC	1.00		0.298	0.774 (0.478~1.255)		0.088	0.620 (0.358~1.077)		0.482	0.698 (0.255~1.912)
TT vs CC	1.00		0.100	0.361 (0.103~1.273)		0.085	0.290 (0.065~1.291)		0.217	0.309 (0.018~8.338)
T alleles (%)	16.7	11.8	0.055	0.672 (0.446~1.011)	9.9	0.012*	0.550 (0.343~0.883)	9.3	0.156	0.510 (0.198~1.312)
MMP-3 −1612
6A/6A	213 (71.0)	88 (75.2)			119 (70.8)			9 (60.0)
5A/6A	75 (21.0)	11 (20.5)			15 (27.4)			13 (33.3)
5A/5A	12 (8.0)	12 (4.3)			18 (1.8)			15 (6.7)
5A/6A vs 6A/6A	1.00		0.345	0.234 (0.145 ~0.569)		0.234	0.356(0.161 ~0.682)		0.767	0.798 (0.207 ~1.307)
5A/5A vs 6A/6A	1.00		0.001*	2.345 (1.876~2.964)		0.560	0.224 (0.066~0.759)		0.990	0.986 (0.120~8.123)
MMP-9 −1562
CC	221 (73.6)	78 (66.7)			111 (66.1)			12 (80.0)
CT	76 (25.3)	38 (32.5)			54 (32.1)			3 (20.0)
TT	3 (1.0)	1 (0.8)			3 (1.8)			0 (0.0)
CT vs CC	1.00		0.143	1.417 (0.888~2.260)		0.102	1.415 (0.933~2.146)		0.627	0.727 (0.200~2.645)
TT vs CC	1.00		0.961	0.944 (0.097~9.214)		0.395	1.991 (0.395~10.025)		0.687	2.531 (0.124~51.741)
T alleles (%)	13.7	17.1	0.208	1.302 (0.862~1.967)	17.9	0.086	1.373 (0.955~1.975)	10.0	0.788	0.702 (0.208~2.366)

Note: *P < 0.05 denotes statistical significance.

Abbreviation: OR (95% CI), 95% confidence interval of OR value.

Table 5 Effects of Risk Factors of Cerebral Infarction by Stepwise Logistic Regression Analysis

Risk Factors	B	SE	Waldχ^2	P value	Exp(B)	95% CI
MMP-2-C1306T	0.375	0.085	17.256	0.000	0. 638	0.494–0. 864
MMP-3-1612	0.034	0.109	0.1	0.002	1.035	0.835–1.280
MMP-9-C1562T	−0.325	0.193	2.82	0.093	0.723	0.494–1.054
Total cholesterol	−0.364	0.091	16.127	0.000	0.695	0.581–0.831
Blood sugar	0.239	0.048	25.087	0.000	1.27	1.156–1.395
Hcy	0.059	0.015	16.029	0.000	1.061	1.030–1.092
Hypertension	1.844	0.2691	47.112	0.000	6.325	3.731–10.711

Abbreviations: B, regression coefficient; SE, standard error; Waldχ², χ² value of regression coefficient Wald test; Exp(B), estimates of odds ratio (OR); 95% CI, 95% confidence interval.