Construction of circRNA–miRNA–mRNA Network Reveal Functional circRNAs and Key Genes in Acute Myeloid Leukemia

Figures & data

Figure 1 Flowchart of this study about constructing a circRNA/miRNA/mRNA network.

Table 1 Sequences of Primers for RT-qPCR and miRNA Related Sequence

Name		Sequence
hsa_circ_0017446	Forward	CAGGGAAGTGCCTAGTCAA
	Reverse	TCAGCTCTGCTCCATCAA
hsa_circ_0012152	Forward	TTGCTGTCTCTGGCCTCATTTC
	Reverse	CTTTGGGTCAGGGCAGGGAAT
hsa_circ_0005273	Forward	GCAACAGGAAATGGAAGAAGA
	Reverse	ATGTGCTGTGGGCTGGGATAA
hsa_circ_0001947	Forward	ACCTTCAATTGAATTTGAGAAC
	Reverse	ATGGTTAGTTAGCAAATTCTTCATT
hsa_circ_0071375	Forward	AATCCGGGCTTTTGCTGATA
	Reverse	TTTCGGTATTATCATCTTTTGAAT
hsa_circ_0009581	Forward	GGCTGTGTCGCAGCCTCT
	Reverse	AATCCACTCGGGCTTTAAACT
hsa_circ_0077765	Forward	ATTTGGATGCAAATATCGCTA
	Reverse	ACACTCTGTGATGGGGCATTT
hsa_circ_0000497	Forward	CGTGCGAAATAGTCAGAGTTTT
	Reverse	GTCAGGGATTTCTCTGATGAGGT
hsa_circ_0058058	Forward	GCTCCGAGAGTAAGGACACC
	Reverse	AGGTTTCTTGCAAATTCCACAAG
hsa_circ_0004277	Forward	ACCAGCCAGCTCTCCCA
	Reverse	TGTCCTTCAGCAGCTAAACG
hsa-miR-382-5p	Forward	5′- GAAGUUGUUCGUGGUGGAUUCG-3′
hsa-miR-150-5p	Forward	5ʹ- UCUCCCAACCCUUGUACCAGUG-3ʹ
hsa-miR-3190-3p	Forward	5ʹ- UGUGGAAGGUAGACGGCCAGAGA-3ʹ
hsa-miR-1193	Forward	5′- GGGAUGGUAGACCGGUGACGUGC-3ʹ
hsa-miR-454-3p	Forward	5′- UAGUGCAAUAUUGCUUAUAGGGU-3′
hsa-miR-3613-5p	Forward	5′- UGUUGUACUUUUUUUUUUGUUC-3′

Table 2 Basic Characteristics of These 10 circRNAs

CircRNA	CircRNA Type	Position	Strand	Gene Symbol	Regulation
hsa_circ_0017446	Exonic	chr10:1125950–1132297	+	WDR37	Down
hsa_circ_0012152	exonic	chr1:44877652–44878394	+	RNF220	Up
hsa_circ_0005273	Exonic	chr8:141710989–141716304	–	PTK2	Up
hsa_circ_0001947	Exonic	chrX:147743428–147744289	+	AFF2	Down
hsa_circ_0071375	Exonic	chr4:166141085–166184511	+	KLHL2	Down
hsa_circ_0009581	Exonic	chr1:8555122–8601377	–	RERE	Up
hsa_circ_0077765	Exonic	chr6:125366356–125398004	+	RNF217	Up
hsa_circ_0000497	Exonic	chr13:78293666–78327493	+	SLAIN1	Down
hsa_circ_0058058	Exonic	chr2:216177220–216190861	+	ATIC	Up
hsa_circ_0004277	Exonic	chr10:1125950–1126416	+	WDR37	Down

Figure 2 Acquired DEcircRNAs of AML. (a) Volcano plots of DEcircRNAs, the blue dots and red dots represent down- and up-expressed circRNAs. (b) Heatmap of circRNAs. Type: (C) healthy controls. (T) AML patients.

Figure 3 Differentially expressed miRNAs in AML patients. (a) Basic structures of the 10 circRNAs. (b) Volcano plots for differentially expressed miRNAs, the blue and red dots represent down- and up-expressed miRNAs. (c) Heatmap of differentially expressed miRNAs. Type: (C) healthy controls. (T) AML patients. (d) Venn graph showing the 6 overlapped genes by intersecting circRNA targeted genes and miRNA response elements from AML patients.

Figure 4 Differentially expressed mRNAs in AML patients. (a) Volcano plots of differentially expressed mRNAs, the blue and red dots represent down- and up-expressed miRNAs. (b) Heatmap for differentially expressed miRNAs. Type: (C) healthy controls. (T) AML patients. (c) Venn graph showing the 33 overlapped genes by intersecting the miRNA targeted genes and mRNA targets from AML patients.

Figure 5 Dot plot of function enrichment analysis. (a) Biological process. (b) Cellular component. (c) Molecular function. (d) KEGG pathway.

Figure 6 ceRNA network. circRNAs, and miRNAs, hub-genes are shown in purple, yellow, and red respectively. circRNAs: dark purple: rising, light purple: falling; miRNAs: dark yellow: rising, light yellow: falling; hub-genes: dark red: rising, light red: falling.

Figure 7 Survival analysis and validation of the 7 genes. (a) mRNA expression levels of 7 hub genes.*p<0.05. (b) The overall survival analysis of RAD51 related to AML patients. P < 0.05.

Figure 8 Quantitative real-time PCR results of circRNAs and miRNAs expression. (a): RT-qPCR of 10 circRNAs (b): RT-qPCR of 6 miRNAs. (c): Relationships of circRNAs and miRNAs. **p<0.05.