Identification Invasion-Related Long Non-Coding RNAs in Lung Adenocarcinoma and Analysis of Competitive Endogenous RNA Regulatory Networks

Figures & data

Table 1 RT-qPCR Primer Sequences Used in the Current Study

Gene	Sequence
LINC00857 F	GAAAAGACACCAAACTCGG
LINC00857 R	CTCATACACTCAACCCAGC
EP300−AS1 F	GTGACGGCTGTGGAGGAGGG
EP300−AS1 R	TTGGGAGGCTGAGATGGATG
PDZRN3−AS1 F	ATGTTCTACCACCCCTCGG
PDZRN3−AS1 R	TTGGCTCTCGTTTCTCCTG
RP5-1102E8.3 F	TTGGTAAATGACATAGGTTTGAATCTCT
RP5-1102E8.3 R	GACCATTCCAAGTAAATCTGATTGTATA
RP3-525N10.2 F	TAAACGAATGCCTGGGATAAACA
RP3-525N10.2 R	CAAAATGACACAAAACCAAAATG
GAPDH F	CCCATCACCATCTTCCAGG
GAPDH R	CATCACGCCACAGTTTCCC

Figure 1 Identification of common DEIRGs and DElncRNAs from TCGA-LUAD cohort and GSE31210 dataset. (A) The volcano map of the differentially expressed genes between tumor and control samples from TCGA-LUAD cohort; (B) The expressions of top 100 DEGs in heatmap from TCGA-LUAD cohort; (C) The volcano map of the differentially expressed lncRNAs between tumor and control samples; (D) The expressions of top 100 lncRNAs in heatmap. (E) The volcano map of the differentially expressed genes between tumor and control samples from GSE31210 dataset; (F) The expressions of top 100 DEGs in heatmap from GSE31210 dataset; (G) Venn plot of overlapping DEGs in TCGA-LUAD and GSE31210 datasets; (H) Venn plot of overlapped DEGs and IRGs; (I) Venn plot of overlapping DElncRNAs in TCGA-LUAD and GSE31210 datasets.

Abbreviations: IRG, invasion-related gene; DE, differentially expressed; lncRNA, long non-coding RNA; LUAD, lung adenocarcinoma; DEG, differentially expressed gene.

Figure 2 Identification of DEIRLs in LUAD. (A) The correlation network of DEIRGs and DElncRNAs in TCGA; (B) The correlation network of DEIRGs and DElncRNAs in GSE31210; (C) Venn plot of common DEIRLs in TCGA-LUAD and GSE31210.

Abbreviations: lncRNA, long non-coding RNA; IRL, invasion-related lncRNA; DE, differentially expressed; LUAD, lung adenocarcinoma.

Figure 3 Identificated prognostic DEIRLs and constructed a risk score model in LUAD from the training set. (A) Univariate COX analysis of DEIRLs in forest plot; (B) Identification of risk signature by multivariate COX analysis in forest plot; (C) The expression levels of IRLs signature in tumor and control samples by RT-qPCR; (D) Relationship between risk score and clinical features. (E) The risk curve and survival status of patients in TCGA-LUAD; (F) Kaplan-Meier curves of survival in low- and high-risk; (G) Heatmap of the expressions of LINC00857, RP5-1102E8.3, RP3525N10.2 in low- and high-risk score; (H) ROC curves of the risk score model for predicting the survival of 1-, 3- and 5-year.

Abbreviations: lncRNA, long non-coding RNA; IRL, invasion-related lncRNA; DE, differentially expressed; LUAD, lung adenocarcinoma; ROC, receiver operating characteristic. *P<0.05, ***P<0.001, ****P<0.0001.

Table 2 Independent Prognostic Analyses

Variables	Univariate Analysis			Multivariate Analysis
	HR	95% CI	P-value	HR	95% CI	P-value
TCGA cohort
Risk score	2.002	1.538–2.605	<0.0001	1.81	1.376–2.382	<0.0001
Age	1.009	0.993–1.025	0.293	/
Gender	1.139	0.836–1.553	0.409	/
N	1.713	1.424–2.062	<0.0001	1.329	1.022–1.73	0.034
Stage	1.594	1.376–1.847	<0.0001	1.232	0.971–1.564	0.086
T	1.549	1.272–1.888	<0.0001	1.278	1.029–1.587	0.026
Smoking	1.052	0.909–1.218	0.494	/
GSE50081 dataset
Risk score	2.665	1.565–4.539	< 0.001	2.027	1.144–3.59	0.016
Gender	1.359	0.755–2.444	0.306	/
T	3.557	1.723–7.34	< 0.001
N	2.516	1.382–4.581	0.003	0.34	0.103–1.119	0.076
Stage	1.773	1.368–2.298	< 0.0001	2.492	1.449–4.285	< 0.001
Age	1.018	0.988–1.049	0.250	/
Smoking	1.36	0.901–2.052	0.143

Note: Statistical significance is shown in bold.

Figure 4 Construction of the nomogram. (A) Construction of the nomogram based on risk score, N staging and T staging for predicting the 1-, 3- and 5-year survival; (B) Calibration curves of the nomogram for 1-, 3- and 5-year; (C–E) Decision curve analysis for assessing the clinical use of nomogram in predicting the 1-, 3- and 5-year survival.

Figure 5 PCA analysis and GSEA of the high and low risk groups. (A) PCA analysis based on the expression profile of 5 prognostic IRLs; (B) PCA analysis based on the expression profile of 45 common DEIRLs; (C) PCA analysis based on the expression profile of all genes in TCGA. (D) GSEA plot of the top 10 enriched biological processes; (E) Ridge plot of the top 10 enriched biological processes; (F) GSEA plot of the top 10 enriched KEGG pathways; (G) Ridge plot of the top 10 enriched KEGG pathways.

Abbreviations: PCA, principal component analysis, GSEA, gene set enrichment analysis, lncRNA, long non-coding RNA; IRL, invasion-related lncRNA; DE, differentially expressed; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Figure 6 Comparison of chemotherapeutic sensitivity between the high- and low-risk groups. The IC50 of Docetaxel, Gefitinib, Paclitaxel, Rapamycin, Gemcitabine and Cisplatin were predicted and compared between low- and high-risk groups. ****P<0.0001, ns P>0.05.

Figure 7 Build a ceRNA network. (A) The volcano map of the differentially expressed miRNA between tumor and control samples; (B) The expressions of top 100 miRNA in heatmap; (C) The prognostic lncRNA-related ceRNA network; (D) The prognostic lncRNA-invasion-related DEmRNA-DEmiRNA extracted from the ceRNA network.

Abbreviations: miRNA, microRNA; mRNA, messenger RNA; lncRNA, long non-coding RNA; ceRNA, competitive endogenous RNA; DE, differentially expressed.

Figure 8 Analysis of ceRNA network. (A) Expression of CPEB1, CORO2B, and GHR in LUAD and NC samples. (B) Kaplan–Meier survival curves in the high- and low-expression groups of three prognostic lncRNAs and three DEmRNAs.

Abbreviations: mRNA, messenger RNA; ceRNA, competitive endogenous RNA; DE, differentially expressed; LUAD, lung adenocarcinoma. ****P<0.0001.

Data Sharing Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.