Changes and Clinical Value of Serum miR-24 and miR-223 Levels in Patients with Severe Pneumonia

Figures & data

Figure 1 Case collection flow chart.

Table 1 Primer Sequence

Gene Name	Forward Primer 5’-3’	Reverse Primer 5’-3’
miR-24	CGCATGTTGCAGCCGTGGT	GAGAGAAGGTGAGGCTCGTG
miR-223	AGCTACGTGCCGAGCACGT	CCGTGATGAGTGACCGACCGTA
U6	CCTGCAGCGTATCTACTCT	AGAGGTGCTGTACGCGATG

Table 2 Comparison of Serum miR-24 and miR-223 Levels in the Three Groups ()

Group	Number	miR-24/U6	miR-223/U6
Control group	93	1.02±0.22	1.01±0.23
Normal group	96	0.76±0.19^a	1.49±0.28^b
Severe group	94	0.60±0.14^ab	1.74±0.37^ab
F	-	121.145	143.782
P	-	0.000	0.000

Notes: Compared with the control group, ^aP < 0.05; Compared with the normal group, ^bP < 0.05.

Table 3 Comparison of Serum miR-24 and miR-223 Levels and APACHEII Scores Between Survival Group and Death Group at Different Time Points ()

Group	Number	miR-24/U6
		Day 1 After Admission	Day 3 After Admission		Day 7 After Admission
Survival group	62	0.69±0.18	0.81±0.16^b		0.93±0.15^bc
Death group	32	0.43±0.16^a	0.31±0.12^ab		0.23±0.09^abc
F	-	Finteractive=44.164, Ftime=53.126, Finterblock=646.600
P	-	Pinteractive<0.001, Ptime<0.001, Pinterblock<0.001
Group	Number	miR-223/U6
		Day 1 After Admission		Day 3 After Admission	Day 7 After Admission
Survival group	62	1.56±0.33		1.41±0.25^b	1.27±0.20^bc
Death group	32	2.09±0.42^a		2.38±0.45^ab	2.62±0.52^abc
F	-	Finteractive=29.714, Ftime=56.467, Finterblock=477.615
P	-	Pinteractive<0.001, Ptime<0.001, Pinterblock<0.001
Group	Number	APACHEII (score)
		Day 1 After Admission		Day 3 After Admission	Day 7 After Admission
Survival group	62	19.30±4.17		16.04±4.10^b	12.81±3.61^bc
Death group	32	25.73±5.65^a		30.94±6.13^ab	37.85±5.67^abc
F	-	Finteractive=83.842, Ftime=97.893, Finterblock=692.227
P	-	Pinteractive<0.001, Ptime<0.001, Pinterblock<0.001

Notes: Compared with survival group, ^aP < 0.05; Compared with the same group on day 1 after admission, ^bP < 0.05; Compared with the same group on day 3 after admission, ^cP < 0.05.

Table 4 Univariate Analysis of Prognosis in Severe Pneumonia Patients [() /n (%)]

Index	Survival Group (n=62)	Death Group (n=32)	t/χ^2	P
Gender [n (%)]			0.028	0.866
Male	36 (58.06)	18 (56.25)
Female	26 (41.94)	14 (43.75)
Age (years old)	50.24±9.78	50.06±8.22	0.089	0.929
Body mass index (kg/m^2)	22.48±2.76	22.61±2.52	0.223	0.824
History of smoking [n (%)]	33 (53.23)	15 (46.88)	0.341	0.559
History of hypertension [n (%)]	24 (38.71)	13 (40.63)	0.032	0.857
History of diabetes [n (%)]	10 (16.13)	5 (15.63)	0.004	0.950
Primary disease [n (%)]			0.302	0.960
Hematencephalon	18 (29.03)	9 (28.13)
Cerebral infarction	22 (35.48)	11 (34.37)
Ischemic hypoxic encephalopathy	13 (20.97)	6 (18.75)
Spinal cord injury	9 (14.52)	6 (18.75)
Mechanical ventilation [n (%)]	11 (17.74)	13 (40.63)	5.813	0.016
Partial pressure of carbon dioxide (mmHg)	36.89±3.75	37.11±4.08	0.262	0.794

Table 5 Correlation Between Serum miR-24 and miR-223 Levels and APACHEII Score, Mechanical Ventilation in Severe Pneumonia Death Cases

Index	miR-24		miR-223
	r	P	r	P
APACHEII	−0.526	0.000	0.502	0.000
Mechanical ventilation	−0.514	0.000	0.518	0.000

Table 6 Predictive Value of Serum miR-24 and miR-223 Levels and APACHEII Scores for the Prognosis of Severe Pneumonia Patients

Index	AUC	95% CI	Sensitivity (%)	Specificity (%)	Cutoff
miR-24	0.867	0.795~0.840	81.3	77.4	0.60
miR-223	0.839	0.749~0.929	68.8	90.3	1.89
APACHEII	0.791	0.688~0.894	53.1	98.4	23.29 score
Combined	0.952	0.910~0.993	96.9	77.4	-

Figure 2 ROC curve of prognosis of severe pneumonia patients predicted by serum miR-24, miR-223 levels and APACHEII scores.

Table 7 Multivariate Logistic Regression Analysis on Factors Affecting Prognosis of Severe Pneumonia Patients

Influence Factor	B	SE	Wald	OR	95% CI	P
miR-24	−0.264	0.082	10.363	0.768	0.624~0.902	0.001
miR-223	1.000	0.305	10.740	2.717	1.494~4.940	0.001
APACHEII	0.076	0.122	0.388	1.079	0.850~1.370	0.533
Mechanical ventilation	0.101	0.092	1.199	1.106	0.924~1.325	0.273